Description :
From Genome Similarity Track
Location :
contig_17:430574- 438307
Transcript NameFunction/comments
g4811.t1hypothetical protein
g4812.t1hypothetical protein
g4813.t1XP_009514425.1 hypothetical protein PHYSODRAFT_320995 [Phytophthora sojae

Sequence
7733 bases(100 bases per row)
CACATCGTGCTGCGCGACGTCAAGCCCGTGTACAAGAAGAAGTTTGGCAAGGATCTGCGCGAGCTGCTGCTGTCCGTGTTCGACTAGGCTGGTGCTGTTG
CTGCACTGTGGTGGTAGTGGTGCGTCGCCGCCGCGCGCTTAAGAGGGTGGAGTGCATCGTAAGCATCTGTGAAATGTGCCAACGTGAACGTGTTTGAACA
AAAGCAACATCCTTGTTGTTCATCTTGGGGCTTCTGAAACGGATGACGTTCGCACACCGAAGCGCCTTTCACCGCGCCAGAAGTGCCCGCATCAACTCTT
CTGCGCCTCTGTGAGTTTGGTGGGGAACTGCACGTCGAACTCCACCACGAGGTTACCTCGTTGCGAGGGTCTCTTCTGCAGCGGCATGTCCTCACCCGCG
ATCAGGTGAGATCGTCACGGTGTCACTGCGTCCAAGCCTCTCGGATTTGCTTTCGAATTGCGAGGAAACCCCAAGCCGACCCGCGACTGCTTTACCACGT
CTCCAAGGACACAAGCGCCGCATTTCACGAAAAGAGCAGATGCACGACCTCCGCAATACTGTGTCGGAGCTATGAACGAAGCTGGAAGGTCTGCGGGCAG
AGTCTTGGATGTGTTCGCCCATGGCATCTCCTGTATCTTGCGCCGCAAGTCAGCATGCGACCGCTCGCCAGCTCATACTGCGTTGCAAAGCAGAAGAAGA
GAACGCCAAATTGCAGGAATTACTGGCATCGCAGAGACGCACGGCCCGCAACATCAGACGCTTGCTCCGACGGGAGCCGGTGACGAGGTAAACGTTGTTG
CGCTGGTTTTTGCTAGTTTTGATGGCTAACAGATTCATTTGCTGAAACTCGTTATTTTGCGTCTGTAGCTGTTAGAAGTGATACACAACTCGAAGCGCTT
GAAGTTTGACAACAACGAGCAGGTTTTCCATGAGCTCCTACACGGAATTGATACGATTTACGTGGATTTTGGCAAGCTGTACGAAGTAAAATGGATGCCA
GCAGTTCCATGCCCTGGGCGGAAGCGCCGAACGGACCCCAATGCCGCCGGCGGTGATGTTTTCGTTGAGTTTGTCGACAAGAACCAAGTCCCCTTCGATT
TTCAGAGAAGTGAGCGCGCAGTGTGGAAATTTCTGCAGGGCCCGCGGGTTCATGACGGAGGTCGTGCCTAGTAGATGTAGCTTCAGAGGCTGCTCGTTTT
TGCCCTTCACTCACACTGTTGTTTGTTTGCTTTGTGGGATCAGGAATTTCAGCAAACTACCGAAACAAGCAAGAGTTGTGTGAGGCCATTCTCGATTTTA
CTGGCTTCGGCTCAAGTCTCCCAACAACTTCCAACATGGTCCGCACCCTGTCGGTTCTAGTGTCTAGCGCAATTGCCCAGGCAGGCATTACCTCGACGTC
CTCGAAGCTCCCGGTCATTTTCTTCCACGGTGTTACCACAACGTGGCAGTTTGGCCACAACTTCGCTGCAAATCTCACTGCTGAAGGACGTGAGGTCGTG
TCACTCTCATTCTGTGACGCCCAGTGCTCCATTGAGTCGCTCCTAATCCAAATCCCTGAGGCCGTGAAGGCCGTCCGCAACACGGTTGCCAACAACTCGG
TATTTGACGATGGATACATGATCATCGGACACTCGCAAAGAGGGATTATCACCCGTGCCACAATCGAAGAAATGGACGACCACAAAGCCAAACGCTTCAT
CAGTCTCGATGGTCTCCAAAACGGGCAGTTCATCGGACACAACGCGGTCGATATCGCCATCGAAAAGGGTGCGCCATCCCTCACTAACATCGTCCCGGAA
CGCGTGTTCAACTATACCAAGTATGTGCCGAAGGACTACTACGGCAAGATGCAGAAGGACTTCACCATCTTCTCCATCGAAAACCCGGACACTCAGTACG
AGTACGCCCAATTCAACGTCCAGCGCTGGCCCCAGTTCGGAAGCTGGTCCATCACGAACAAGTTCCTGCCCGTGTACAACAACGTGAACCCGTGTCCCCC
TGGCAACGACCAGTGCATCAGTGACCAGCAGCGTCGCCGAGCCAACTTCCTCAAACTCGAAGAAGCCCACTTCTTCGCGTCACCCGTCGACGACGCTATC
ATGCCGTGGGAGAGCTGCCTCTTCGGGCGCTACAGCGAGGTGGACACGCTCGACGAAATCGAGACCAGCTTCATGAACTTGATCATTGTCAACATAACAG
ACACGCACGAGTACAGGGAGGACACGTTCGGAATGCGCACACTGGATGAGCGCGGTGGCCTGCACCTCCATATCGCTCCCATCGTGACGCACAGTTGCTG
GTGCGTCGACGAGAAATACTGCAAGTGGGCTCCCGTGTACGACGAGTACATCTACCCGGCTTTGAATTGAGCTTCGACTTTTGAAGGGGGCGGGCAGATA
AAGTAAACGATGTTAGTGAGGACTCACGTTGGACCACACAAAAGCTGAAGGCCGACCCGGATTGAAGCCTGGCGACACTACAACGAACGTGGCAACAAAA
CACACTGAGTGTCTTGGATGCCACTTCATTATTGACAGCGGGATTCCCCGGCGAAATATGATGCCTCATACTGCTCGGAAATGTCACTCTTGGACAAACG
TTTCCTGCGGAGGCACTAGGGCATTCTTGATGGAGTAACAACCGTGCCTCCACCACAGCCAATCACTACTGCCGCTGTGCCATCGGCTCCCGCACAAGCT
TCCTCTGGAACGGCCATCCCACAATCCCTCAGTCCCTTGAGCCAAGAAGACTTTGAGTTGGTGCTAGCGCGCATGTGGGTCATTTATGCCTTGCCGTCCA
TTCTGATTGAAGCACCAATTGTGCGCCTGTTGTTCTCCCGGTTGGCTACCCATTTAAGACTGCCGTTCAGGTCCTGCTGATATCAGTTTGTGACGAAATC
CAAGCCACAGTCATCGCGATTATCAGGAAAACAGGCGTAGTGAAACTCGTGACTGATGCTTATACTGACGCCAATAAGTCGAACATCATCCATTTTATGG
TGACTGGTCCAGGCATGAAATCATTCTACTGGTCGTCGCTGCATACGGGGACGGCGCAGCACACAGCGGAATACTTGGCGATAGAACTGGAACGGGTGAT
TAATGATATTCAGACGAAGACGGGAGCAATGGTGACAACAGTGCTGACCGATAATGCCAGCAATATGTCTGGCGCTTGGGCAATTTTGGAGAGGAGGCTA
CCTGTGTTTGGTGGTGGTTGTCTGCTCACGGTCTCAACCTCGTGTTGGAGGAGGTGTTCTCGAAGATCCCCTTCGTTACTGACCTGAAAAGTACAAATTT
GCCCGATTGGTTCGAGACCATCATGGGCTTCTGGAGTAGTTCAGAAATTTGCAAGAGTCCATGGTGGAGAGGCTTCAAAAGGAAGGCACCGTGCCTCAGC
AATTCCTGACCCACCCGATGGTATTCCCAGCACTCCTGTCTTAAGAGCGTATTGACAAACCTCGAGCCTTCCTCTTGGACCCAAACACTGACACGTCGCA
GTTCGTTGATTCGGATGAGGCGGCGGGCACTGTTGGAGCAATGAAGATAAGGCGGAGTGTGCAGGGGCGAGACCACAGAGCTGGTGAAAAGTCAATGCGA
ACAAGAACGAGATGTATCGAGCGATCTCGCACCTTGCGGATATTGTGTTCTCTATTTCGACTTCATCGGCAGCAAGTGAAAGGGCTTGGAGTATTATGGA
CTTGGTGGTATGCTTTCCGACAACAAGATTGATCTCGCGCATCCCGAGTCGGGAGTGGAGGATACCAAAGTGATCCAACACCAAGACTTGATGTCGATTT
GAGAACAGTGTCTCCGTTAAACCTCGTAGCTAGCGAGACATCCATAAGTTTATGAATTCATGACGTATGCATGCTTTTTCCTATTGTTCATTCTCTCATT
GCGTCGCGCGTTCTGGGTTATGTTGGTTGTGCGGCCAAATTAATAGGAACAAGTTCGGAAACGATCCGAGCAAACCTTCGGAAAGTGTTCGCAACCAGCA
CTATTCTCAGTTGGGCAAATCGAGCTACGCTCCCACGTCTACGGTCCAGAATGTTTTACCGCGTGCGAGATCTAGCAAGAAGTGCTCTCGATGTGGTTTG
ACAACGAATTGCTCGTCCTCACTTCCAATGGAAACTACATGGCTTCGTTTATCACATGGATTATCCAAGAACGTCGGCCGACGTTCTAGCTTCCTGCTTA
TTATTATTAGAGAGTAGACGACCGCGGCCAAACCGGGAGAAGGGTGGTTGGTTATTGTTTCCACGGCACAACCGCAGCCTTCAGATTGTCGACCACACGG
TGTCCATGCTGGCTAAGCAGCCGTCACGGCTGGGCCCGCACCACTCGATGGAAACCATGGAGACCGCAGGCAAGTTCGAGCCCTTTCGGTTGATCCATCG
CCTGCTGGTGTTCGCTATCGCGCTGTGGTACGTGGCCATCTCGGCGCAGGCCTTCGTGGCTGCAGTCACAGTGCTGCGAGGCCTCGAGTCGAAGGATCTA
GGTGTAACCGTGTACACGTCCAAGCTCATTGCAGGTTATGCTGGCGAGACCACTATCCACGACAGTCCATTGGTGCAGAACGTGTTGGGAGGGTCAACCG
AACCCCGGGACGACGCGATTTATCTCGAGACGGATACCTCCGTCTCGTTCACAGGATGCTCAACTTTTGAAGGTGCAGACAGCAGCGTCTACAGCAACGG
CTTTACTCGGCTGCTGTTCACCTCTTTGCAGAAGCACGCGAGGGGAAATCTCTCGTACGTCGAGGAGCTCGAACTCATCGCACCAGTTGTAGACTGCACG
TTTGAGCTGCTGGTTTCGGCCGACGAAGAGGTGACAAAGCTGCGGATGTACTATTTGGCGCGCCAGAAAAGAAATGCCAGCGAGGTGCTGCTACTGTCGG
CGTTGATGTCGACGCAGGATTTCCAGGTGAGCCAGCAGTATCAAAGTGGGGCCGCGTTGCTAGCCTCAATTGCGGCCATTGAGGACATGCGCGCCACCGA
AGTTGTGCACCACTTTGCCATGGCCTACAATTACCCCTACGAGGATGAACCCCATTTCGCTGTCAGTGAGCTAATTGGCGTCGAAGAAGACAACTTCTGG
CTGTTCAAGAGCCAACCCAATGAGGGAAGCATCGACCCGGTAAAAGAAGTACGTTCGGCGTATCGCTTCGGGGGCTACATTGACGACCCGGTGGCTCAGT
CCAACGTTGAAATCGTGCACTGGAATCTGCAAGCCGATCCTGCTTCGGAGCTAAGCAACTGGGAATGGCATTCGCTTGCTTCTCTGCACGACTCATGGGC
CTGGACACACACGATTCACGGTATTTTCGCAATGGATGTATTCTTCGATCTGGAGATTCTCTTCTTCGTGATCTACCACCGCGCTCGAAAGGGCCACTTC
TGGGTGGGCGACGCGTTTGCCACCATTTCCAATGCACTACTATATCGTGGCGTGCTGATCTTCGCCGCGAACCATCTCAACGGGTACTGGACGCTTACAG
AGTTCTGCCTCGCGATCGGCAACGAGGTTGCCGGGCGCCGATCGATTCATTACCGCCCCGAGATGGTACACGCTGATCTACTAACGTTCTTCATGAACGT
GGCCAGCATTTTGAGCTACCTGTTTCGGGAGCGAATCGACCCAGTACTGGCATGCACCGCGTTCGAATTCGGCTTTGCGTACCGAGTCGAAATCGTCAGT
GGCATGTCCTCACTAAGAAATGTTGTCGCCGGCTTTGCGGAGAAGGATCACTGGCTTGGACTCATTAATGTTAGTCCGTTCCTCACGAGGTTATCGCCCA
TGAAGTTCTGGACGGTGCATGAGATCAAGACTGACCGCAAACCCGTCGTGATTGCCACCGTGCTCTCCATCTTCAGCATGATACTTTGGCTGGTGCTGTA
CATCATCGCTCGCAAGGCTTACCGCTACTGTAAGCGCAAGCACGATGGCGCTAATCACCGAGCCAGCCGCTACGCCTCCAAAGAATACGGGTCGGAGGGA
GAAGACGGTCTCACGTCGTTCGAGTCAGCCACGGGGTCGGCTCTGAGCAAGCGCTATGGCGTCATCTCCGGCTACGACAATTACGTCGTTCGCAACGACA
AGCGCTATGCATCCATTGATGCCGTATACGGCAACGGGTTTCTCGTCGCAAATGGTAAGTTCCTCCTTTCAACGGAGGATATTTTCTCGCTGTTGGTCAT
GAAGGTCACGCGTGTGCGCTTCACGAACATCTACGTGTACGCGATCCTGGCGGACGGCGCCGTGAACCAGACAGCTCAGCTCGTATACCCTCACACGATC
CCATGGGACGACTTTGGTCGAATTGGTGTCGCCAAACTCTCGTAACAGGCAGCGAACAGGTATGTAGGGCCTGTCAGTGTAAATGGTGAAGCACAACCCC
ATATCGCCGCGTGAGGATGTCGATGCGCGCCCGGACATCCTTCACTGAAAGCCATCAAGAGAGCGTTTCCTGCTCGACTACAGACGTCTTTGGACAGAGA
ACACCACTTAACGGCAATCGACACGTTCATTTTCTGTTGTCATCGCAGTGTCATCGACCAGCCTGCCAAACCAGAGGCACAAGGGTCGATGAATGCGTGT
GTGAAAGAACACTTCCCCACACGCCCTACCTCTGTCTGTACACCTCTTGCTCTGACTCAGCTGCCCTTGGTGCCGCCCTGTATGGTACTTATTTGATAGG
CTTGCGCTCGAGGGGCTCACCCTTCAGCACCTTCTCAATTTCAGCACCCGACAGCGTCTCGTACTCTAGCAGTGCCTGGGCCAGCTTCTCCAGGTCTCCG
TGCTTACTTACAAGGATATCCTTCGCGCGCGTGTAGGACGCGTCGCACAGCTTCTTCACTTCATCGTCGATGGTCTTGCGCGTGGTGGCGCTCGTATCGT
TGCCACGGAGGTCGTGGAAAACAAGACCCACGTCCGAGCTCATGCCGTACTTGGTCACCATCGTACGAGCAACATTCGTGGCCTGCTGGATGTCAGACGA
CGCGCCTCCCGTGATCTCTTCCTCGCCGAATGTCAGTTCCTCCGCCACGCGGCCGCCCATACACACATCCAGCCGTGCCAGCAGTTGCTTGCGTGAAATG
GACGTCTGGTCACCCTCCGGCAGCTGTGAGACCATGCCCAATGCCTGGCCGCGCGGCATAATGGTCGCCTTATACACGGGGTGAGCTCCTGGAGTGTTAA
TAGCTACCAGCGCGTGGCCTCCCTCGTGGTAAGCAGTAAGCTTGGCCGAGTCGGGTGTGATCAGCGCCGACCTGCGCTCCGCGCCCATGAGGATCTTGTC
CTTGGCGTATTCGAAGGCATCCATATCCACCACATCAGCACTCTTCATGGACGCGCGCAGAGCAGCCTCGTTCACGAGATTGGACAGCTCCGCACCAGAC
ATGCCGGGCGTCGCACGCGCGAGCACGTCCACGTCCACATCGTCTCCAAGAGGGATCTTTCCAGCATAGAACTCCAGGATCTCCTTGCGGCCAGCGACGT
CGGGCAGATCCACCGTCACATGACGGTCAAAGCGACCTGGACGGATGAGCGCGTTGTCCAGCACGTCGGGGAAGTTGGTGGCGCCGATCACGATTATACC
CTTGTTCTGGTCGAAGCCGTCCATCTCCACGAGGAGCTGGTTGAGCGTCATCTTCATGGCCTGCTGCTCCTTGAGTTTGCGCGTGCCGCCGATCGCGTCG
ATCTCGTCGATGAAGATGATGCACGGAGCCTTC