Description :
From Genome Similarity Track
Location :
Scaffold_647:4305- 6703
Sequence
2398 bases(100 bases per row)
ATCCGATGCCGAAGAAGGGCCGTTGGAAAACGATCGACCAGCGCGTTTGTAGAGGGATTGCAAATTATCTATCCCTCTTACATCTCCGAAGAGACAAGAG
CCCTCCACCAGGGATCGGTCATAGATTGGGCCACTTTTGGAGCTCGTGCCAAGTTGTTCACACAACATTAGCATGCATCACCCTGGAGAGGCATGGTAAC
CCATCCCTTTCTCGATAACCGATGCAGTTTGTAATGTGCACCGGTAGAAGTCCTCTTCTCAAACTGATTGCGAGACAGGGTCAACTTGTAAAGCCAGGCA
TCGCATCCAGTCTCCCCAACATTAAGGATGAAAGCGTTACATGCTCGGATCAGCGAGGCACCATCACGTTTATGGTTTCCGCTGTACTATCGATGTTTGA
AGAACACATCGATGTAGAACTCATGCTCAGTGAGAAATTCACTCGCACTAGCTTCAATGCCATGAAGCCTTGATGAATCGAAAAGCCTTATTCGATAACG
ATTGCTTATCGTGTCGGACAAGCGATCCAACACTCTCTGAGGAGGCAGCCACGCCTTTTCCTCAGGAGCAACACACATGACGTCGCTATCTCTGGCTTCC
TGAGTGGTGTCAATAGAAGCACCGACACCACGACCAGCACGGTCGTCTTGATTGTGACGCATTACTGCGTCACCGTCATCGTAGTTCAACTGGCTCGTGC
CACCGCCTTGATTACTCTCAAGCGAACGACACCGCCTTGAAGACGGTGCGTCCAACTCGTCGGACGATCCGAAGATGTCACGACGCGCAGCAAGAATCAT
GGTGCCTTGCGAGATCGACTTGCTCGGCTCTTTCGTCGCCGCTTTTGGCTCTGTCTTAGTGGCAGCTTTCGTCGAGTCGAAGTTTCATTTCACGGTTATC
CAACTATTTAGACTACCTATCGTGTTTGTTCGACACTGGCTTAAACTGGTCGAATAAGGGGAAATCCATACGAACCTATAGTAATTTGGTTGGCAACAAA
AAATCCATAGTAACCCTATTGCAAAACGTTTGTAGGGGAAATGCCATAGTAATGAGGTACGAGACTTCGAGACTAAAGAAAGCAAATACTAGAATCTGGA
AGGCTGAAATGAAGGGACCAGGATATGAGTATACAAACCGCAAGTATAGCTGATAATTTGAGAAAAATATCCTATCCTTCTTCACCTGTTAAGTAGTAAC
TTAGTGGTATAGAGTCTCATAGTAGTGTAGTTGCTACGTGGCGTGAGTCTGAGTCCCATAGGGTGCGAAGCTAGGAAATTGGGGGTAGTTCACGAAATGG
TCCAAATTGGAGGGCTCGCGGTAAACGCCTTCAGTTGATGTAGTGTGGGAGTAGTTACTTGACCCTGGTTTAAAAACGAACGACCGTCCCCCGAGTTGTC
TTGGGTGTTCAAACTGAAAGCCTTCAATAGAAGGTCACTGGTAGTAAAGCTGTAACGGTAGTAGGCCGAGGCGTTAAGGGGCTATAATAACGGCAAGTTC
GATCACTCCAATGTGCCTACGTAACAAGTGACTCGGATCGGCGTAAGCTGTGGCCACAAATAGACGCAATAGAAAACCAATAGGACCCAGGGTGGAGCAC
GAACAAAGGAACAAAGGCGTAATGTTCAAAATGCAAAAAAAGGTCAAAGAACCGCAAGGGTAAAGGCAAAGACGAAAGATAAAGGCAACAAACCGAGAGG
CAATAAGCCAAAGGGCCAAGTAAAAAAGCAGAAGCCAAAAGGCGAAAGCTAAAGGCCAAAGTCCAACGACGAAAGTCCAAGTCAATTTTATGTAGCCAAA
AGACCAATCGAATAAATAGAAACTCCCCGTATCCAATAGTAATAGGAAGGACCCAATTTGATGACACCGTAACAAATGAAGAGAAGATAACCGTGAACGT
AACCCACCGCCTTAATTTAAAGAGTCGCGCTGGTGTGGTGAAGCGCTTATCAAAAGCGGTGGACCTACGGTACAGTGAATCGAAGGTACCGGAGATAAAG
TGACCACGGAGAGGACACGAGCTTGGGACGAGCGGGATTTGCAAGACGAACGGTGGGAAAATCATTACCAGTGTACCAGTTAAACAATACCTCAGGATGC
CGACCACTGTCTCGTTAGAAGGACCGGTACATAGGGGCAGCCCTTAGTTCCCCGGGGGTCGACCGCGGCCCTTTATCGGTGGTCCAGGTCTCTTATTGGT
AGACATCGGTCCCTCATCGGTGGACCCGGTATTGTGGTAAGGTGCTTATGGAAAATAATAGACCCGGAGGCTATCGCAATGAAGGGAGAAGGGTCCACCT
TCAGGTATATGGTGTCTGAGAGAGAAGGGGTCACGAAAGTGGTTGGAACCTCAGAGAAGAGGTACCCGTAGAACCTATCAAGAAGAAGACCGTTACCC