Description :
From Genome Similarity Track
Location :
Scaffold_882:4305- 5901
Transcript NameFunction/comments
Phyke_g11329transmembrane protein

Sequence
1596 bases(100 bases per row)
GATGACTATCAAGAAGTGAAGACCCCCGATCTGCTTGAGGATGGCGCCATTCGCCCGGGAGGCCCGCCCGATCTGTACAGCTGGGGCAACATCGGTCTTC
TGGCGCAGTACGCTGCCATCGGCGTGATCTACGGCACCATGTACAGCGCAATCTACCCGTTCCTGACGAATTACCTGCGCATGTCCGGAAATGAGACCAC
GTCTGCAAGTGTATTGATCACCCTGCCATACACGCTCAAGGTCTTCATCGGTATCATCACCGATTGCTACCCAATCTTTGGATACCGTCGTCGTCCCTAC
ATGCTCATCGGCTGGGGTGTATGCTTCGTGGCTCTGATAGTCATGACCATCCTCCCTATCGGCGACCCGTACTACCCCGACGCAAGCTGGTCGTTGCTCA
CCACCCTCACGGAAGAACAATCGGCGCAGATCAACACGGGTGCGCAGCATTCGGGTGTCAAGTACATCTTTCTCATGGTCATCGCCAACCTGGGCAGTGT
CGTGGCCTTCACGGCTTCAGATGGTATTCTGGTTGATCTTGCCCAGCGCGAGCCTTTGAAGGTCCGAGGTACGGTGCAGTCTATTGCAGTCGCGGTGCAA
TACTTGTTCCAGATCATCGCGTACGTTATGACTGGGTTTGGCCTCAACAGCTCAGACTACGGCGGCACGTTCTCCGGCTCCATGGGCGTCAACGCCGTCA
TGGGTGTGtgtgcagccttctcgcTGGCTGTCATGCCCTTCTCATGGTATTGCATCACGGAGGAAAAGACTCACTCCCGCTCGGCACGGAAATATTTCTG
GGCGCTGTACgaactcatccagcagcgtgtggtGTACCAGATCGTTCTGTTCCGCTTCTGCCGCAATGTGTTCTCTTGGGTCACTGTGACGGCAGCGTAC
CCGATCCAAAGCGTCTGGGTCGGTGTGACGCCTGTAAACAGCAGTGTGGCCAGTATTATCGGGCTCGTCGTATCCGCTGGCTCGTTGTATGTGACCAAGG
AGTTCGGTCtcaactggaactggcgctggatgatcgCGTTCTCGCAGATCgcggtggtggtgatcgACGCGTTCCCCACGTTCTTTACCATCTGGGACGT
CCACCGCAACCAATGGTTTTGGCTTGGTGTGCCGCTCGTTGAAAACTTCCCGACCGCAGTTGGCTACATCATCTCTACGTACGCGGTGCTAGAGATTATC
GAGGAAGGCAATGAGGCTACAGTCTACGGTCTTATCACCACTGTCTCCACGCTGGCTTCACCATTCGCCAGCGTCATTACGAAGAGCATTGACGGCGCTT
TTGATGTGGAATCGACCTACCTGCTGTTGGACAATTCATATGTGCGCTGGCAGGTGTCGTACACCTACTTCATCGCCTACgccttcaagctcttctcgCT
TGTGTTCCTTGTGTTGCTGCCGAGACAGAAGGTCGAGACACAGGAGCTAAAACGCACTGGTGGAAAGAACAAGTGGATCGGTATCTGTACGTTTGTCGGC
ATCGGCTTCACACTGGTTTGGTCTGTCATGGTCAACCTCATGACTATGTTTGACAGTACGTCCTGCCTCCGTATCGCTGGTGGAACCGGGTGCTAG