Description :
From Genome Similarity Track
Location :
Scaffold_18:43042- 44100
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_18-snap-gene-0.28Kinesin-associated protein

Sequence
1058 bases(100 bases per row)
TAACCTCTCGTTCGACCCGACGCTGCGTGAAGTGCTCGTGAAAAACAGCCTGGTCCCCAAGCTCGTGGAGCTGCTCAAGAAGCCGCCGTTCCGCGCCCTG
TCGCTGCGCATTCTCTACCACTTGAGCATGGACGACCGGTGCAAGTCCATGTTTACGTACACCGAGGCCATCCCCATCGTCATGCAGCTCGTGGTGCGTG
CCCCACACGTGTCCTTAGTAACAACCGGGGTTCGTTTCTCACGGTCCGATCTCGTAGATTAACTTTCCGCAAAACGTTGTGGCCAAGGAGCTCGCCGCGC
TGGCCGTCAACCTGAGTCATAACGCTCGCAACGCTGAGCTCATGTGCCAGAACCGCGGGCTCGAGGCCCTCACGACCCGCGTCTTTCGGACCCGCGACAC
GCTACTCATGAAGGTCGTCCGCAACCTCTCGCTCTGGACCTACACGCTCCAGGAAGACCTCGTGAGAGACAAGCTGTACAAGCACCGCGGCATGTGGGCG
CCCTTTGTGATCCCGATGCTCGAGCTGCTGCTAAGCACCGACAATCACGACTTTGCCATCGAAGTGATGGGCACGCTCGCGAACCTCACGCCCAACGATT
TGCCCATCAAGGCGTCGTGGGACAAGCTCGTCGCGGACCACAACCTGGTCCCGTTCCTCAGCAAGCTGCTCGTGCCGGGCTTCTCGCAGGACGACATGGT
GCTCGAGGTCGTGCTGTTCGTGGGGGCACTCGCGCTCGAGCCAAAGTGTGCCCCGCTGCTCGCGACGTCTCGTCTGCTGCGTACGTTCCACGCCCTGTTC
CAGGAAAAGCAGCACGACAACGAACTCACGTTGCAGCTGCTGTACGCGTTCTACCGACTGCTGCGCCACCGCGAGACCTTCGATGAGATCATCTATGGCG
TCGGCTTTGTGCCCAACTTGCTGCTCGCGGCCGACTCGCCCAACATTGAAGTGCGGCGCATGTGCGACGTCGTCATGGACCTCATCTTGGACCACGACAT
TGGCAACGGCACCATGGGCGAGTGCGGACGGCTCATCCGCCAGCGGCGGTTCGAGATT