Description :
From Genome Similarity Track
Location :
Scaffold_181:43017- 48370
Transcript NameFunction/comments
Hyaar_Emoy2812038hypothetical protein
Hyaar_Emoy2812039protein phosphatase 2A regulatory subunit
Hyaar_Emoy2812040hypothetical protein
Hyaar_Emoy2812041glutamine amidotransferase subunit pdxT putative

Sequence
5353 bases(100 bases per row)
CTAAATTGGAATAAGCTTGCGGAGCCGAGCGATCAGATAAGGTTTGCAGGCTAGCGTCGAGCAATGTGGTCACTTGGCAAAAGCGATACTGTCACAGTTC
GATTGCCAAGTCGGACGTGCTGAAAGCGGTGTACCACGTGTAATCGGTCTTTCTGTCGGATAGAGCTCACAGTTTACTTCTCAAAGTGTCCGTCGAACCC
GACAAATCCTGCCATGAGGAACACGTAAAAGAAGGACTTCTTCTCTATCCGGGAGCACCAACTCCAGGCGCTAGTCAAGCGACCATCAATGCAGGAGCCA
GCATCAAAAAAATTGTCCGCACCACTACCATCAAACCCGTGCTTGAAAAAGTCACACAATATACGTTTTTGGAGCGTCTCCGCGCCGCCAAAGCTGTCCT
CGATGTACGCGCGCGTATTCGACTGCACTGCTAGCACTGGAATTTCATGCACCGTGTTCACGATCGGGCTCAGGATGCGAGAAATCTGCGTGTACTTGTC
GATGAACATGAGCGCATTGGGTACATTGTGGTCGCCGAGATGTACCATCGAGGAGCCCACCCAACGAGGGCGCATCTTTTGCGTATGGTTCAAGATCGAG
TGCACCAAACGAGATGTCTCGGGTGCATGCTGCATGCGGTTAAGACCCTGACCGGTGTCACGAAGCCGGTACATGCTTCCGCCCAGCAGATCTTCTTCGA
CGGCCCACCACAGACGCAGCATTGAGGTCGTGATGTTCTTCCAGAGCAGCAGCGACTGTAATACGTACTCGTACTGGCTCGCGTGGCTGTGGCTGAGTCG
CGCGCCATTTCTGCCGGCTTTGATCTCGAGGCTGAAACCTGGCTCGGGCCTCTCTGGATTGAAATATTTCTCTAAGTATTCGATCATTCGCGTGATCGGC
GCTCGGTTGGATGCCAGATAGCTCTGGCCATCCGCAATTGATGCGAGACATAGACGAATCTCCTCTTCCGATAACAACGCCGACGAATAATCACGCACTA
GCCCATCGATAGCCTGCTGCTTGTCACGCAAAAACCGTTGCAAGTTTTGCGCATCAGCAGGCAAGTCAGGGCATGTAGCTGCAGCAACAGACGTCGCCAC
GGCACATCGCGTATCCCGCAGCATATCAAGAGCACGGCGTTCTTCCAGCAACGTTGCTACCGTCTTTTTTGGTGATACACACGAGAAGCCAAGATACTTT
CGAATTTCACGAACATTGGCATCTTGCAGCAAGTAGATCATCTTGCCATAATTATTGCGCATGCGTTCGGGGTTCATCACTTTATATCGACGTCCAATCT
CAAACACCCGACCGAAAAAGTCCTCATTGTCCTTAAACTGCTTTTGCTGTACAAGTCGACGGCCTTGGCGAAAGTTGTTGGCAATCAAGAGCCCCGAGAG
AACACCGAATGTCTCATTTAATTCGTGCAGCATGCGCTTCACCGTTGAGTACGACGACAACACGTCGACTGCGTCCGTGTACTCGCTCACGTTCAGCGCT
GCATCCAGCAGATTAAACAGCGCCCGTTCGTCCTCGCTGAGTCGCAAAGGAATGAACGCCGCCTCCTTCATCAGTGCAGATGGGACCGCTTCGATCTCGC
GCATCACCAATTCATCATCATCATTATCCGGATCTTCTGCCTCGAGCGCTTCTTTTTGATCCGCAGTCACGTCCGTTGTAACCGCCACAGGAGTTGGTAG
CGGTGGTACAATAGCTGGTATGTCCTCTGGCGGTGGTACATGCTCGATGAGAGGTTTAGTAGATAATTCATGATGAGACGCAGGACTGACAGCGATATTA
CTGCTGCTGAAGCTTCCTGGTACCTCTGTCGTTCGGTGTTTCAAACGTGAGCCAGCGTGATGCTGCGCCTTGAAGCACAACGGGCAGTATAAGTCGTCGC
AGTCCTCGCAGCGGACGGCAGCCAGTGTGTCCTCGCACTCGACGCACATCGCCATAATTTACCAGAACTGCTACTACGTATCAAGTCCTGCGATTGGTCA
ATTATCCGTAACCTCTCGTAGCGATACGATCGAGCACAGGTATGTAGCCACTTCATGCCGCCGCTTCTATCGTCCAATCCTGCAAATATCCTGCTTTTAC
GTACGATACATAATCTTAGGCAAAGAATAAGCCCCGCCAAACTGCGTCCAAGCCCGTTCTCGACCGACACCGACCTCGACTCCCCCCCTCCTTCCTCTCG
CCCCAACATGGGTACGTCCGACGTTCTTCATGTCCCGTCCCGCTAGTCTTGCACCTTGTATCATGCCTCATCACCTCACTCACTCATCGTGTCTCTCTAT
ATATATATATATCTACCTCTGTCTCTGTCTGATTGGACGTCTGCTGTCCTTTGAATGGGTTCATAGAGGACGAAGTGTACCCCCTCACGCTTCTGACCGA
AGAGCTCAAGAGCGACGAAGTGGAGACGCGAATCAAAGCCATGCGACGTCTGCGCACTGTAGCACAAGCGCTGGGGCCCGAGCGCACCCGCTCGGATCTG
TTGCCGTTTCTTCGTGGTAAGCCAGTGTGCGGTACACATCACTCTCTCTTTTTCACGAGATATAGTGTAACAAACGACCGTAAACATGTCGGCCTTACTG
CAGCAGAAGCTACCGAAGACGAAGATGAAGTGGTTGTGGCGCTCGCCGAAGAACTTGGCGGCTTTGTGGACCTCGTCGGTGGCGCGGAACATGCCTCGAT
ACTGGTGGAGCCCCTTGAAGTCTTGGCTGGAGTCGAGGAGACGGTGGTGCGAGACCGTGCCGTTGACTCGTTGCAGAAGGTGGTGGCTGTAGTGCCCAAC
GTGGACGACGTGATGGTACCGCTGGCCAAGCGTCTGGCTGAGGGTGACTGGTTCACATCGCGCGTTTCCGTGTGTGCGCTCTTTGCATCGATCTACAGCA
AGTTGGCCGACGCTGGACGCAAAAAGGAGCTGCGCGAGTACGTGGTCGGCGTGTTTGTGTGTGTTTTGGCGGTCGACAACTTTGCAGGCTAAGTGGTGGT
ATGTGATCTCGCAGCTTTTATCAGATGATGGGCAACGACGACACGCCAATGGTTCGTCGTGCTGCTGCTGCCAACATTGGTAAGTTTGCCGCGGCGATGG
AGAAAGAGCACATTGCAGGCATCATTCTGCCGCCGTTCCGAGCACTTACGGCGGATGACCAGGACAGTGTGCGTCTGCTGGCTATTGAGAACTCGACGGC
GATTGCCGAGCTGCTGTCGGAGAATGACAACTTGATGCACGTACTTCCTATTGTGCGCTCATCCGTGGAGGACCGCTCGTGGCGCGTACGGTTTAGCATT
GCGAAGGACTTTTTTCCACTTTCACGCGCTATGGGATCGCAAATTACAGAGTCTGAGCTGCTCGGTTGTTTTAGCAATCTCCTTCAGGTTCGAATGCAAT
GCAAACCATGGAGATAGAACGAGCTGTGTTGTTCATCATGTGTGCTGCTGGTGTTGTCGTTCTTGTCGTCATTTTGTAGGACGCAGAAGCCGAAGTACGC
GCTGCCGCTGCGAAGAATCTACCGGGCTACATCTCGATCGTCAAGAACGAGCTGTTCAGGAGTGAGATTCTTCCACTGCTGTCAGCATTGTCGCAAGACA
CAGCGCCCAATGTTCGCAGTACGTGCTATTGCCATTCCATTCTGTTTATCACATGAAGCAAGTACTAACCCTGTCTTGTTGTCGACGCGTTCCCGAATCG
CAGCGGCTGTTTCTGTCGCATGCATGGAGCTTGCACCCAAGCTGGGCGAAGCCACGTCCAAGTCGACACTAGCCCCTCTGCTGCTTCTCTTCTTGCGCGA
TGAGATTGTGGACGTGCGTTTGAACATTCTGAAGCGGATGGAACTTCTTGCCCAATGGATGTCTTCGTTTGAGTCGGTACTTCTGCCGGCCATTGCCGAC
TTGGCACGCGACCTGCAGTGGCGTGTGCGTGAGGCAGTAGTTCTATCGATTCCTGCTCTTGCCGGCAGTCTGGGCGCTCAGTACTTCCAGGAGCACTTGC
TGGAGACCTACGTTAGCGCTTTCACAGACATGGTGGGTGAGGTTCGTTTGAGTGCTACTAAGATTCTGCCACAGCTACTGGAGTCTCTGGGCAGCGACAG
CATCCTTCAGAACGTAATGCCGCGCCTGAACCAGATCTTCGAGAAGTCTGTTATCTACCAGGAGCGAGTCAATGTGCTGCACGCGCTAAAGCAGATGGCC
GTGGAGAAGGTGTCGAGCGACTTGCTGAGTCTCATGACGACACTAGCTATCCGTGGCGCCCACGACAAGATCCCTAATGTTAGATTCGTGGCTTCCATGA
GCTTAGAGCGGCTGTGCAAATTCGCTGATGCATCTGTGGTCGCGGCTCAAGTCCGGTACGTTCAACAGCAGTGTTTAGCTCATTTTGTCTTTGACGTTGT
CCGGAATTGACTGCATTGTGTACTAACCCACATTTGTAGACCCTGCCTGACGGAGTTAGTGAATGATCCCGACATGGACGTCAAGTACTACTCAAGTATC
GCACTCGATGCAGCCCAGGGCTAGGCAGCGCAGAAACGTGCTCGTCCATGCGACTTGCGGAGACGTCTTGATCCTCTTTCAATTCATTTCTGGATTTATC
TTTGCGTTGAGCCCCTTTTAGAGAGAAAGACGCGGTGAGACCCGATTCGTGCTTATCCGTTTTCCTGTTCCACAGTTGACAAGCTGCAACAGACATTGAC
GGCAAGCAGCGACAGTGTTGTTGGTAGCTCATTGACTGCTCACCCTTGACAGACAAATATCACGGAAAACCATAGCAACGTCTTTCAGCAAATGAGACTA
ACTTGGTCCAGAAACAATGCCTTTGCCGTGGTCATAGTGGATATCCTCACGTGGCCTTCGCTCTATCTACAGTCGAGGCAGGACAATCGTCTCAATAAAG
TACTGATGCCAGTGTGTGTCGGTCGTGATCTCCGGGTGGAAGGCTGTGACGAGGATATTGTCCTTCCGCGCGGCAATAATCACGTCTTTCGCGTCCGACC
CGTCTGCTGGCGTAGCAGTAGCTACACGAGAGAGCACCTCAATTTCCTCGCCAACCGAGATAATAGCGGGTGCACGGATAAATACGGCGTTGTACGGCTG
GTCATTAAAGCCCGGTGGACCGTCTATGGACTTGTGCACCGAAAAAGTTGCGCGACACCTGGACGTCGAGTCCGCCGATCAACGTCTGACCACCCTCTTC
TGTGTGCTTGGCGTGCTGGCTGAGCATGATCATACCAGCGCACGTGCCCCAAATGGGACGACCATGAGCCACCCATTTCTTCAGAGGCTCTACGAGCCCC
CAGCGCACAGCCACTTTGCCGATCGTCGTGCTCTCGCCACCAGGCAGAACGAG