Description :
From Genome Similarity Track
Location :
Scaffold_210:43013- 46208
Transcript NameFunction/comments
g10639.t1hypothetical protein

Sequence
3195 bases(100 bases per row)
GTGCAGACATTCGTTGCGCTTTGCTACTGGTCGGTCCACCGTCCAGTTCCTTTGAATCACCAGGCCACCCTTGACATGTTTGCACAAGAGACACTGGTTG
ACAAACCGAATCACCGCTTGGCGAGCGTTCGCTAAGACGAACCTGCGATCCAAAAGCTCCACCATCACATTCACACCTCGGTGCCCTTGGGGGCCACAAT
GCGCCACCACAAACAGACGCTTCAACACCGCCTTTGCTTGTGCAGGCAGCCACAGCTTGTCATCCACTTCAATCCCGTCACTAGTCATCACGGCGCTGTC
GGGTGCATCTCCCTCATACTGATGCTGTGCTCGAACAATCTCAGAGCGCGTCGGCCACGTGAACTCGTCGTCCTGTAGTGGACGCAGCTCAGACAGTGCC
TGAGCCGACCGTGTAGTCACTCGCTTAACGGCCAGAGACTTGACTGTATCAGGAGGCGCAGGCTGCCCCCAGCGTGATATGATATCCGCCCAAAGGTTGT
TCTCGCCGGCGATATGATGGATGACATAGCGACAGCCCACTAGCTTCAGCGCCCAGCGTTGCAGTTTCCCCTTCACGTGCTGCTTCACCTCTCTGTCAGG
TGTGAAGATCTGAATAAGGTTTGAATGGTCGCAGTACACGTGGAACCCTTTCTCACGCGTGAGCATGTAGTCCAGGTCCCCACACGCCTTCACGATCGGA
TACCCTTCCTTCTCGACGATCGACCAGTTCCTCTGCGCATTCTTGAACAGTCCGCCTCGGCAGATCAGCAGTTCATGCTGCTGCTCTTCAACCGGGACTC
CATCCTGCCAATTCAAGACCTGGGTCAACACCAGTGCATACCCAGTCAGCGAGGCGTCCGAGAACAAGCACACCGTCGCCCTTTTATCCGGGAACGCCAG
CTTGCATGATCGCTCGATCATCTCGAGTGTTTTCCGAAATGTTTCCGCCTCTTCCTTACTCCATTCCACCACAGCTCCACTTAGCTGAGCTTTACGACGC
CCACGAGACTGCATCACGCGCTCGAGTTTTTCCTGCAGCGGCGCAGTTGTGCGTGCATAATCGACCATCGAGTCTCTCAGCCAATTCAGTGCGCACAGGA
AATGCTGGAGCGCAGCACCGGTCGGTGGCAATGGCATCTGCCGCAGTGCGGCTAATCGTTCAGGGTCGTGCTCGACACCAGCTCCATCGATCACCTTGCC
ACACCATTTAACACGCTTCGCAAAAAGTTTGCACTTGCGAGCGTTCAACTTCAACTTTCGCTGCCGTAGAATGGCGAAGAACTTGCCAAGACTCTCCAGA
AAAGCTCCAGCAGTGCATGCGTACAGCAACACGTCGTCAATCCAGACAAGCACGTTCCGAAATAATAGGTCCCTCAGTACTTCGTGCATTTGGGCTTGAA
AGTGCACTGCAGAGTCGCAAGCTCCCTGTGGCACGCGGGATGGCGTGAAAACGCCGTCTTCCGTCACGAAACTGAACAGCTCCCGGCTGTTCGGATGGAG
AGGCATCTGCCAGAACCCTTTGTGGAAGTCAAATGCACCAAATCCGTACGACCCACGCACGGACTCCGTCACCACGGCGAGATTCGGCGCAGCACCAGCC
AGTGGCACCGTGAGCCGATTGACGGGCCTGTAATCGATAGTGATTCGAAATTCATCCGTGCCACGTTTAGCTACTGGCAGCGCGGGACAGGCCCAACGAC
TCTGGGTGTTCCGCTCAACGAGTCCTGCATCCTCCAGTTCTCGCACATACTCCCGAAGAAATTGGCGCTGAGCCTCAGGATAGCGCCGGACGCCGCTACG
ATACGGCTGTACACCGCTCTCCAACCGCACTTCGAGTGGTTGGACATCTGCAGCTTCATCACGGCCAAGGCGGACCCTGAAGACGTCGGAGTATTCCAGC
ACCATTTGCCGTAGTTCATCCGCCATAGCCGGTTCAAAGCCGGCTTGAATGGCCTCATCGACCATGTTGTGCAACAATGTATCGATCTCATTGTCCTCAC
TATTTCCAAGCACATCCATGTGGTCGCACGGGATGTCATCAGCTTCAAACTCGGCGGCCTCAATGTGCTGTTGAGCCAACTGCTCGAAAACCCCATCAAG
GTCCACGCCGATCGATTGCAGTGTCGACTTGCCGAGCAACAGCTCCTCCTCGGGTGCTTCAAGCACAAGGCACTCAATGCCGCTCAAGCGCAATGGCCCC
GCCGCCGTTACGATTTGCACATCGAGATGTATTTTCTCGTGACAAAGCATCGCATTGCCGCCAGCAGCGACAACCTCCAGCGGTGGATCAATAATCACCG
TTGACAGCTCTGGCAACAACTCCCTGAGTTCGGCCATCACTGGGCGGCCAATAATGTTGACGTCAGAGCCCGTGTCTGGGCAGTAAGGAACGTCCAGCAC
ACCGTTGATTACAGCACTGCGGAAAGCTGGTTCCCCATCGGTTGTGATCCTCTTGACACGCTCCTGCGCACGACTCCGTTTCTCACGCAGCATCTTCTCC
ACGTTGGCCTTCTGCTCCGCTGTTGCCGTCGGGCAGTCTCGGGCCCAGTGAGGCCCCTTACACACCAAGCACCCGTCGCGAGGAGGTTTCCGGGGGCCCG
CGGCACCCCGACCACCGCCCTGAATGCTCGATGGCTTGGGAAGTTGCTTTGCAGGTCGACCGTGCGCTTTGGCTGCCGCACCGCCGTCCTCCTTCGGTCG
CAGACTGGAGCTTTGCTTCATCTCATTCTGCATCAAATAGTACTGCTGCTGACGTGTCGCTCGCTCAATCATCAGGTCATGAAGTGCGAGGTCATCGACC
TTCGCTTCGCGATGGGTCAACTCGACCAACCGAGTCAAGTCGACTTTCAAAATCTCGGGGGTCACGTGTGTCAGTAGCAGCTTGCATCTCATCTTCAGTC
TCTGCCGACCCGCCTCACCAACAGCTGGTCCACGGCCCAACATACCAGTTAGACCGTTGTCTTCGACCAGTCTGTCGAAGCCCATGAAATACTTTGCGAT
CCGGGCTTCGACATCGACCTCTTCCAAGTCCATCTTCAGCTCAGCAAAGAGCCGGGACACATCGGGGACTCGGTCGTTCACCATTCCTCCAACCTTACGC
TTCATCTCTGCTAGAAGCATAGCGTCGGTCACACTCTCCACTTCCTTCTTGAGAATGTAGTGAGTCACATGCTCCAATACCCGGGGTTTCAAAGA