Description :
From Genome Similarity Track
Location :
contig_17:430109- 439812
Transcript NameFunction/comments
g5065.t1hypothetical protein
g5066.t1hypothetical protein
g5067.t1XP_009514425.1 hypothetical protein PHYSODRAFT_320995 [Phytophthora sojae
g5068.t1hypothetical protein

Sequence
9703 bases(100 bases per row)
GAGCTGCTGCTGTCCGTGTTCGACTAGGCTGGTGCTGTTGCTGCACTGTGGTGGTAGTGGTGCGTCGCCGCCGCGCGCTTAAGAGGGTGGAGTGCATCGT
AAGCATCTGTGAAATGTGCCAACGTGAACGTGTTTGAACAAAAGCAACATCCTTGTCGTTCATCTTGGGGCTTCTGAAACGGATGACGTTCGCACACCGA
AGCGCCTTTCACCGCGCCAGAAGTGCCCGCATCAACTCTTCTGCGCCTCTGTGAGTTTGGTGGGGAACTGCACGTCGAACTCCACCACGAGGTTACCTCG
TTGCGAGGGTCTCTTCTGCAGCGGCATGTCCTCACCCGCGATCAGGTGAGATCGTCACGGTGTCACTGCGTCCAAGCCTCTCGGATTTGCTTTCGAATTG
CGAGGAAACCCCAAGCCGACCCGCGACTGCTTTACCACGTCTCCAAGGACACAAGCGCCGCATTTCACGAAAAGAGCAGATGCACGACCTCCGCAATACT
GTGTCGGAGCTATGAACGAAGCTGGAAGGTCTGCGGGCAGAGTCTTGGATGTGTTCGCCCATGGCATCTCCTGTATCTTGCGCCGCAAGTCAGCATGCGA
CCGCTCGCCAGCTCATACTGCGTTGCAAAGCAGAAGAAGAGAACGCCAAATTGCAGGAATTACTGGCATCGCAGAGACGCACGGCCCGCAACATCAGACG
CTTGCTCCGACGGGAGCCGGTGACGAGGTAAACGTTGTTGCGCTGGTTTTTGCTAGTTTTGATGGCTAACAGATTCATTTGCTGAAACTCGTTATTTTGC
GTCTGTAGCTGCTAGAAGTGATACACAACTCGAAGCGCTTGAAGTTTGACAACAACGAGCAGGTTTTCCATGAGCTCCTACACGGAATTGATACGATTTA
CGTGGATTTTGGCAAGCTGTACGAAGTAAAAGGGATGCCAGCAGTTCCATGCCCTGGGCGGAAGCGCCGAACGGACCCCAATGCCGCCGGCGGTGATGTT
TTCGTTGAGTTTGTCGACAAGAACCAAGTCCCCTTCGATTTTCAGAGAAGTGAGCGCGCAGTGTGGAAATTTCTGCAGGGCCCGCGGGTTCATGACGGAG
GTCGTGCCTAGTAGATGTAGCTTCAGAGGCTGCTCGTTTTTGCCCTTCACTCACACTGTTGTTTGTTTGCTTTGTGGGATCAGGAATTTCAGCAAACTAC
CGAAACAAGCAAGAGTTGTGTGAGGCCATTCTCGATTTTACTGGCTTCGGCTCAAGTCTCCCAACAACTTCCAACATGGTCCGCATCCTGTCGGTTCTAG
TGTCTAGCGCAATTGCCCTGGCAGGCATTACCTCGACGTCCTCGAAGCTCCCGGTCATTTTCTTCCACGGTGTTACCACAACGTGGCAGTTTGGCCACAA
CTTTGCTGCAAATCTCACTGCTGAAGGACGTGAGGTCGTGTCGCTCTCATTCTGGGACGCCCAGTGCTCCATTGAGTCGCTCCTGATCCAAATCCCTGAG
GCCGTGAAGGCCGTCCGCAATACGGTTGCCAACAACTCGGTATTTGACGATGAATACATGATCATCGGACACTCGCAAGGAGGGATTATCACCCGTGCCA
CAATCGAAGAAATGGACGACCACAAAGCCAAACGCTTCATCAGTCTCGCTGGTCTCCAAAACGGACAGTTCATCGGACACAACGCGGTCGATATCGCCAT
CGAAAAGGGTGCGCCATCCCTCACTAACGTCGTCCCGGAACGAGTGTTCAACTACACCAAGTATGTGCCGAAGGACTACTACGGCAAGATGCAGAAGGAC
TTCACCATCTTCTCCATCGAAAACCCGGACACTCAGTACGAGTACGCCCAATTCAACGTCCAGCGCTGGCCCCAGTTCGGAAGCTGGTCCACCACGAACA
AGCTCCTGCCTGTATACAACAACGTGAACCCGTGTCCCCCTGGCAACGACCAGTGCATCAGTGACCAGCAGCGTCGCCGAGCCAACTTCCTCAAACTCGA
AGAAGCCCACTTCTTCGCGTCACCCGTCGACGACGCTATCATGCCGTGGGAGAGCTGCGTCTTCGGGCGCTACAGCGTGTTGGACACGCTCGACGAAATC
GAGACCAGCTTCATGAACTTGGTCATTGTCAACATAACAGACACGCACGAGTACAGGGAGGACACGTTCGGACAGCGCACACTGGATGAGCGCGGTGGCC
TGCACCTCCATATCGCTCCCATCGTGACGTACAGTTGCTGGTGCGTCGACGAGAAACACTGCAAGTGGGCTCCCGTGTACGACGAGTACATCTACCCAGC
TTTGAATTGAGCTTCGACTTTTGAAGGGGGCGGGCAGATAAAGTAAACGATGTTAGTGAGGACTCACGTTGGACCACACAAAAGCTGAAGGCCGACCCGG
ATTGAAGCCTGGCGACACTACAACGAACGTGGCAACAAAACACACTGAGTGTCTTGGATGCCTCTTCATTATTGACAGCGGGATTCCCCGGCGAAATATG
ATGCCTCATACTGCTCGGAAATGTCACTCTTGGACAAACGTTTCCTGCGGAGGCACTATGGCATTTTTGATGGAGTAACAACCGTGCCTCCACCACAGCC
AATCACTACTGCCGCTGTGCCATCGGCTCCCGCACAAGCTTCCTCTGGAACGGCCATCCCACAATCCCTCAGTCCCTTGATCCAAGAAGACTTTGAGTTG
GTGCTAGCGCGCATGTGGGTCATTTATGCCTTGCCGTCCATTCTGATTGAAGCACCAATTGTGCGCCTGTTGTTCTCCCGGTTGGCTACCCATTTAAGAC
TGCCGTTCAGGTCCTGCTGATATCAGTTTGTGACGAAATCCAAGCCACAGTCATCGCGATTATCAGGAAAACAGGCGTAGTGAAACTCGCGACTGATGCT
TATACTGACGCCAATAAGTCGAACATCATCCATTTTATGGTGACTGGTCCAGGCATGAAATCATTCTATTGGTCGTCGCTGCATATGGGGACGGCGCAGC
ACACAGCGGAATACTTGGCGATAGAACTGGAACGGGTGATTAATGATATTCAGACGAAGACGGGAGCAATGGTGACAGCAGTGTTGACCGATAATGCCAG
CAATATGTCTGGCGCTTGGGCAATTTTGGAGAGGAGGCTACCTGTGTTTGGTGGTGGTTGTCTGCTCACGGTCTCAACCTCGTGTTGGAGGAGGTGTTCT
CGAAGATCCCCGTCGTTACTGACCTGAAAAGTACAAATTTGCCCGATTGGTTCGAGACCATCATGGGCTTCTGGAGTAGTTCAGAAATTTGCAAGAGTCC
ATGGTGGAGAGGCTTCAAAAGGAAGGCACCGTGCCTTAGCAATTCCTGACCCACCCGATGGTATTCCCAGCACTCCTGTCTTAAGAGCGTATTGACAAAC
CTCGAGCCTTCCTCTTGGACCCAAACACTGACACGTCGCAGTTCGTTGATTCGGATGAGTCGGTGGGCATTGTTGGAGCGATGAAGATAAGGCGGAGTGT
GCAGGGGCGAGACCACGGAGCTGGTGAAAAGTCAATGCGAACAAGAACGAGATGTATCGAGCGATCTCGCACCTTGCGGATATTGTGTTCTCTATTTCGA
CTTCATCGGCAGCAAGTGAAAGGGCTTGGAGTATTATGGACTTGGTGGTATGCTTTCCGACAACAAGATTGATCTCGCGCATCCCGAGTCGGGAGTGGAG
GATACCAAAGTGATCCAACACCAAGACTTGATGTCGATTTGACAACAGTGTCTCCGTTAAACCTCGTAGCTAGCGAGACATCCGTAAGTTTATGAATTCA
TGACGTATGCATGCTTTTTCCTATTGTTCATTCTCTCATTGCGTCGCGCGTTCTGGGTTATGTTGGTTGTGCGGCCAAATTAATAGGAACAAGTTCGGAA
ACGATCCGAGCAAACCTTCGGAAAGTGTTCGCAACCAGCACTATTCTCAGTTGGGCAAATCGAGCTACGCTCCCACGTCTACGGTCCAGAATGTTTTACC
GCGTGCGAGATCTAGCAAGAAGTGCTCTCGATGTGGTTTGACAACGAATTGCTCGTCCTCACTTCCAATGGAAACTACATGGCTTCGTTTATCACATGGA
TTATCCAGGAACGTCGGCCGACGTTCTAGCTTCCTGCTTATTATTATTAGAGAGTAGACGACCGCGGCCAAACCGGGAGAAGGGTGGTTGGTTATTGTTT
CCACGGCACAACCGCAGCCTTCAGTTTGTCGACCACACGGTGTCCATGCTGGCTAAGCAGCCGTCACGGCTGGGCCCGCACCACTCGATGGAAACCATGG
AGACCGCAGGCAAGATCGAGCCCTTTCGGTTGATCCATCGCCTGCTGGTGTTCGCTATCGCGCTGTGGTACGTGGCCATCTCGGCGCAGGCCTTCGTGGC
TGCAGTCACAGTGCTGCGAGGCCTCGAGTCGAAGGATCTAGGTGTAACCGTGTACACGTCCAAGCTCATTGCAGGTTATGCTGGCGAGACCACTATCCAC
GACAGTCCATTGGTGCAGAACGTGTTGGGAGGGTCAACCGAACCCCGGGACGACGCGATTTATCTCGAGACGGATACCTCCGTCTCGTTCACAGGATGCT
CAACTTTTGAAGGTGCAGACAGCAGCGTCTACAGCAACGGCTTTACTCGGCTGCTGTTCACCTCTTTGCAGAAGCACGCGAGGGGAAATCTCTCGTACGT
CGAGGAGCTCGAACTCATCGCACCAGTTGTAGACTGCACGTTTGAGCTGCTGGTTTCGGCCGACGAAGAGGTGACAAAGCTGCGGATGTACTATTTGGCG
CGCCAGAAAAGAAATGCCAGCGAGGTGCTGCTACTGTCAGCGTTGATGTCGACGCAGGATTTCCAGGTGAGCCAGCAGTATCAAAGTGGGGCCGCGTTGC
TAGCCTCAATTGCGGCCATTGAGGACATGCGCGCCACCGAAGTTGTGCACCACTTTGCCATGGCCTACAATTACCCCTACGAGGATGAACCCCATTTCGC
TGTCAGTGAGCTAATTGGCGTCGAAGAAGACAACTTCTGGCTGTTCAAGAGCCAACCCAATGAGGGAAGCATCGACCCGGTAAAAGAAGTACGTTCGGCG
TATCGCTTCGGGGGCTACATTGACGACCCGGTGGCTCAGTCCAACGTTGAAATCGTGCACTGGAATCTGCAAGCCGATCCTGCTTCGGAGCTAAGCAACT
GGGAATGGCATTCGCTTGCTTCTCTGCACGACTCATGGGCCTGGACACACACGATTCACGGTATTTTCGCAATGGATGTATTCTTCGATCTGGAGATTCT
CTTCTTCGTGATCTACCACCGCGCTCGAAAGGGCCACTTCTGGGTGGGCGACGCGTTTGCCACCATTTCCAATGCACTACTATATCGTGGCGTGCTGATC
TTCGCCGCGAACCATCTCAACGGGTACTGGACGCTTACAGAGTTCTGCCTCGCGATCGGCAACGAGGTTGCCGGGCGCCGATCGATTCATTACCGCCCCG
AGATGGTACACGCTGATCTACTAACGTTCTTCATGAACGTGGCCAGCATTTTGAGCTACCTGTTTCGGGAGCGAATCGACCCAGTACTGGCATGCACCGC
GTTCGAATTCGGCTTTGCGTACCGAGTCGAAATCGTCAGTGGCATGTCCTCACTAAGAAATGTTGTCGCCGGCTTTGCGGAGAAGGATCACTGGCTTGGA
CTCATTAATGTTAGTCCGTTCCTCACGAGGTTATCGCCCATGAAGTTCTGGACGGTGCATGAGATCAAGACTGACCGCAAACCCGTCGTGATTGCCACCG
TGCTCTCCATCTTCAGCATGATACTTTGGCTGGTGCTGTACATCATCGCTCGCAAGGCTTACCGCTACTGTAAGCGCAAGCACGATGGCGCTAATCACCG
AGCCAGCCGCTACGCCTCCAAAGAATGCGGGTCGGAGGGAGAAGACGGTCTCACGTCGTTCGAGTCAGCCACGGGGTCGGCTCTGAGCAAGCGCTATGGC
GTCATCTCCGGCTACGACAATTACGTCGTTCGCAACGACAAGCGCTATGCATCCATTGATGCCGTATACGGCAACGGGTTTCTCGTCGCAAATGGTAAGT
TCCTCCTTTCAACGGAGGATATTTTCTCGCTGTTGGTCATGAAGGTCACGCGTGTGCGCTTCACGAACATCTACGTGTACGCGATCCTGGCGGACGGCGC
CGTGAACCAGACAGCTCAGCTCGTATACCCTCACACGATCCCATGGGACGACTTTGGTCGAATTGGTGTCGCCAAACTCTCGTAACAGGCAGCGAACAGG
CATGTAGGGCCTGTCAGTGTAAATGGTGAAGCACAACCCCATATCGCCGCGTGAGGATGTCGATGCGCGCCCGGACATCCTTCACTGAAAGCCATCAAGA
GAGCGTTTCCTGCTCGACTACAGACGTCTTTGGACAGAGAACACCACTTAACGGCAATCGACACGTTCATTTTCTGTTGTCATCGCAGTGTCATCGACCA
GCCTGCCAAACCAGAGGCACAAGGGTCGATGAATGCGTGTGTGAAAGAACACTTCCCCACACGCCCTACCTCTGTCTGTACACCTCTTGCTCTGACACAG
CTGCCCTTGGTGCCGCCCTGTATGGTACTTATTTGATAGGCTTGCGCTCGAGGGGCTCACCCTTCAGCACCTTCTCAATTTCAGCACCCGACAGCGTCTC
GTACTCTAGCAGTGCCTGGGCCAGCTTCTCCAGGTCTCCGTGCTTACTTACAAGGATGTCCTTCGCGCGCGTGTAGGACGCGTCGCACAGCTTCTTCACT
TCATCGTCGATGGTCTTGCGCGTGGTGGCGCTCGTATCGTTGCCACGCAGGTCGTGGAAAACAAGACCCACGTCCGAGCTCATGCCGTACTTGGTCACCA
TCGTACGAGCAACATTCGTGGCCTGCTGGATGTCAGACGACGCGCCTCCCGTGATCTCTTCCTCGCCGAATGTCAGTTCCTCCGCCACGCGGCCGCCCAT
ACACACATCCAGCCGTGCCAGCAGTTGCTTGCGTGAAATGGACGTCTGGTCACCCTCCGGCAGCTGTGAGACCATGCCCAATGCCTGGCCGCGCGGCATA
ATGGTCGCCTTATACACGGGGTGAGCTCCTGGAGTGTTAATAGCTACCAGCGCGTGGCCTCCCTCGTGGTAAGCAGTAAGCTTGGCCGAGTCGGGTGTGA
TCAGCGCCGACCTGCGCTCCGCGCCCATGAGGATCTTGTCCTTGGCGTATTCGAAGGCATCCATATCCACCACATCAGCACTCTTCATGGACGCGCGCAG
AGCAGCCTCGTTCACGAGATTGGACAGCTCCGCACCAGACATGCCGGGCGTCGCACGCGCGAGCACGTCCACGTCCACATCGTCTCCAAGAGGGATCTTT
CCAGCATAGAACTCCAGGATCTCCTTGCGGCCAGCGACGTCGGGCAGATCCACCGTCACGTGACGGTCAAAGCGACCTGGACGGATGAGCGCGTTGTCCA
GCACGTCGGGGAAGTTGGTGGCGCCGATCACGATTATACCCTTGTTCTGGTCGAAGCCGTCCATCTCCACGAGGAGCTGGTTGAGCGTCATCTTCATGGC
CTGCTGCTCCTTGAGTTTGCGCGTGCCGCCGATCGCGTCGATCTCGTCGATGAAGATGATGCACGGAGCCTTCCGCTTGGCCGACTCGAACAGGTCGCGC
ACGCGGCGCGCGCCCACACCTACATACATCTCCTCGAACTCGGAGCCCGACGAGTAGAAGAAGGGCACACCGGCCTCGCCGGCAATGGCACGGGCCAGAA
GCGTCTTGCCCGTGCCTGGTGGGCCGGTGAGCAGCACGCCCTTGGGCAGGTTTCCTCCGAGCCGCGTGAAGCGGGCCGGGTCTTTCAGGAACTGCACGAT
CTCCTCGAGCTCCTGTTTGGCCTCAGTGGCCCCCTTGACGTCGCTGAAGCGCTTGTCGCTGCCGGTGGGGCCCATGACCTTGGAGGCCGAGCCAATCTTG
CCCACCTTCTCGTCCAGCATGGCCCCGAGGGCAGAGACCACGAGGAAGGCCACGCCCAGCGTGCGCAGCGTTTTCCACATGTTACTCTTGAAGCTGCCTT
CCACCATGGACACGAAGACCGGGTCGTGGGCCGACTGGCCCTGGCCATTGCGGGCCGCGGCCTGACTGGCGGCGGCCACGCCTCAAACTGTCGGGCCGCG
CAACCGTGCCATAGGCCTGCTCGACCGGCTGGGCCAGCTGCGGAAGGTCGACCGTATCCAAGCGGCCCGTCTTGACCAGGGCCTTGATATACTCCTTCTG
CACGGCTTCGTCCAGCGCGAAGCGGTTCTCCTCCACGCGACGCACCACGAGGGCCGGGTAGTTGCTGCGGTTCAGCTCCTGCAGGAAGCGCAGCTGCGCG
TACGCGTCCTCGGGGCTGGAGTTGGCCGCCTGCTCCAGCGACTTGAGCTGCTTGAGCTTCCCGCGCTGCGTCATGTTGAACAGCGAGCGCTTGGCGCCGG
CGGACGGTACCGGCCGAGCGAAGGCCGGGGCGGGCCACGCACGCGCAGGCGTCGACAGCACGCTGGCGCGACTGGCTGCGCGCTGAAGGAGCAGCAGGCT
TCTTGGCCGCAGGACGAGCATGAGGGCTTCTGGCTAGGCTGCGTGTTTTCTAATGAGCGTACAATTGTGTGTACAAACACCACTATGGTGTGTGCCACTT
CGTTTTGAGGAATGACGGTCTGCCGTTTGCCCCGTCACCAGAGGCAAGCACCCGCAGTACGATACGTTCGCTAACGGTGGTGGCGGCGAGTCCAAGCAAA
GGCTGCAGGACGCAGCATTCCAGACGCTGACATCTGCAAACTACTGGCGGAGAAGGCCGTGGTGCTGGCGGCGAACAGTGCCGATATCATTGCGAGCGAG
GCGGCGAACCGGAAGGTACTGGTAGAAGGTGGGAAGCTGGCAGCTACTCGATACGACGGTGCAATACCAGGAGACTTGTACTCGCTGGCAGCATCTCCTA
CAGGATTATGCTAGTTATGATGGCGAGAACCAAGCAGCCAAGGACAGAGACGTTGACCGACTTGTCGACGAGGAGGAACGGGAAGAGGGTCGCGTGTCGA
AGGAGCAGTTCTCCAACTACCTTGACTCGCTGGGAGGCATGAAGGTGTACATTTTCCTGATCGTGGTGCAGACGCTGTGGCACGTGTGTCGGATCGGTAG
TGACTTGTAGCTGGACCGGTCACGGACGCCGACATCTGGTCGGCACTGGAGAAAGTGGGCATGAAGGCGCAGGTGTCGGCGCTGGAGCGCCAACTGACGT
ACGAGCTGAGTGAGAACTTCAGCGTGGTCGAGCAGCAGATGCTCGTGCGCTGCTGACTGGGAGCCGCATCGTGGTGATGGATGAGGCGACGGCGTCCATC
GACCACGCGACAGTGCTGACGATCGCGCATCGGTTGAGCACGGTGCTGGACTCGGACGTTAATGATGATGCGATACCACGAGACTTGGTGGAGGCTGACA
GTCCTCGTGAGTTGGTGAAGGAACTGAAGGGCGGTTCTGTCAGCTTGCAAGGGAAGGCGGCTGTCTGGCTAGGCTGCAAGAACAATGCTCCTTGTGCATT
GCTGTTGAAGTCTACCCCATTAATCGGGGGAAGGGGGTGCAGATAAAGGAAACCGTGTTGGTAGGGACTTACGTTGGACCACACAAATGTAGCTATCACT
TGC