Description :
From Genome Similarity Track
Location :
contig_17:430108- 439811
Transcript NameFunction/comments
g4811.t1hypothetical protein
g4812.t1hypothetical protein
g4813.t1XP_009514425.1 hypothetical protein PHYSODRAFT_320995 [Phytophthora sojae
g4814.t1hypothetical protein

Sequence
9703 bases(100 bases per row)
CCAAAACAAGAAAAAACATGACGTGGCTACGCTAATTCAAGGACGTGGGGATCCCGATCAAGACTGGGCGCGTGGCCAGCTTCATGGTCCACAACAAGTG
GACGATTCGTCAACGGTGAGTTTGTTTTACAAGGCACGGGCAACTAGAGCACGGCCGCGTTCGATGGAGCCCGCCACGCAGAGACGTTTGAGACGCGCAC
GACTCAGACGCACCTTGATTCGTATCAAGCGCTAGTTCGAGCTGCTCTGGGAAGAAGGACGGGTGCTTCAATGGGCCTCAAGTATTCTGCTTGCTTCATG
TACTTTGGGGAGGACGAGGACGAAACAAAGTACCCCCAGGAGAGGAGGACGAGGACGTTGTTCATGTGTAGGATGTGGTTTAACGTGCACGCCATTGTTC
AGCAGATGCCCATGAGCGAAGTCAACAAAGGCATTGCTATGATGCGTGAGGGCCGTGGTGCGCTACCACATCGTGCTGCGCGACGTCAAGCCCGTGTACA
AGAAGAAGTTTGGCAAGGATCTGCGCGAGCTGCTGCTGTCCGTGTTCGACTAGGCTGGTGCTGTTGCTGCACTGTGGTGGTAGTGGTGCGTCGCCGCCGC
GCGCTTAAGAGGGTGGAGTGCATCGTAAGCATCTGTGAAATGTGCCAACGTGAACGTGTTTGAACAAAAGCAACATCCTTGTTGTTCATCTTGGGGCTTC
TGAAACGGATGACGTTCGCACACCGAAGCGCCTTTCACCGCGCCAGAAGTGCCCGCATCAACTCTTCTGCGCCTCTGTGAGTTTGGTGGGGAACTGCACG
TCGAACTCCACCACGAGGTTACCTCGTTGCGAGGGTCTCTTCTGCAGCGGCATGTCCTCACCCGCGATCAGGTGAGATCGTCACGGTGTCACTGCGTCCA
AGCCTCTCGGATTTGCTTTCGAATTGCGAGGAAACCCCAAGCCGACCCGCGACTGCTTTACCACGTCTCCAAGGACACAAGCGCCGCATTTCACGAAAAG
AGCAGATGCACGACCTCCGCAATACTGTGTCGGAGCTATGAACGAAGCTGGAAGGTCTGCGGGCAGAGTCTTGGATGTGTTCGCCCATGGCATCTCCTGT
ATCTTGCGCCGCAAGTCAGCATGCGACCGCTCGCCAGCTCATACTGCGTTGCAAAGCAGAAGAAGAGAACGCCAAATTGCAGGAATTACTGGCATCGCAG
AGACGCACGGCCCGCAACATCAGACGCTTGCTCCGACGGGAGCCGGTGACGAGGTAAACGTTGTTGCGCTGGTTTTTGCTAGTTTTGATGGCTAACAGAT
TCATTTGCTGAAACTCGTTATTTTGCGTCTGTAGCTGTTAGAAGTGATACACAACTCGAAGCGCTTGAAGTTTGACAACAACGAGCAGGTTTTCCATGAG
CTCCTACACGGAATTGATACGATTTACGTGGATTTTGGCAAGCTGTACGAAGTAAAATGGATGCCAGCAGTTCCATGCCCTGGGCGGAAGCGCCGAACGG
ACCCCAATGCCGCCGGCGGTGATGTTTTCGTTGAGTTTGTCGACAAGAACCAAGTCCCCTTCGATTTTCAGAGAAGTGAGCGCGCAGTGTGGAAATTTCT
GCAGGGCCCGCGGGTTCATGACGGAGGTCGTGCCTAGTAGATGTAGCTTCAGAGGCTGCTCGTTTTTGCCCTTCACTCACACTGTTGTTTGTTTGCTTTG
TGGGATCAGGAATTTCAGCAAACTACCGAAACAAGCAAGAGTTGTGTGAGGCCATTCTCGATTTTACTGGCTTCGGCTCAAGTCTCCCAACAACTTCCAA
CATGGTCCGCACCCTGTCGGTTCTAGTGTCTAGCGCAATTGCCCAGGCAGGCATTACCTCGACGTCCTCGAAGCTCCCGGTCATTTTCTTCCACGGTGTT
ACCACAACGTGGCAGTTTGGCCACAACTTCGCTGCAAATCTCACTGCTGAAGGACGTGAGGTCGTGTCACTCTCATTCTGTGACGCCCAGTGCTCCATTG
AGTCGCTCCTAATCCAAATCCCTGAGGCCGTGAAGGCCGTCCGCAACACGGTTGCCAACAACTCGGTATTTGACGATGGATACATGATCATCGGACACTC
GCAAAGAGGGATTATCACCCGTGCCACAATCGAAGAAATGGACGACCACAAAGCCAAACGCTTCATCAGTCTCGATGGTCTCCAAAACGGGCAGTTCATC
GGACACAACGCGGTCGATATCGCCATCGAAAAGGGTGCGCCATCCCTCACTAACATCGTCCCGGAACGCGTGTTCAACTATACCAAGTATGTGCCGAAGG
ACTACTACGGCAAGATGCAGAAGGACTTCACCATCTTCTCCATCGAAAACCCGGACACTCAGTACGAGTACGCCCAATTCAACGTCCAGCGCTGGCCCCA
GTTCGGAAGCTGGTCCATCACGAACAAGTTCCTGCCCGTGTACAACAACGTGAACCCGTGTCCCCCTGGCAACGACCAGTGCATCAGTGACCAGCAGCGT
CGCCGAGCCAACTTCCTCAAACTCGAAGAAGCCCACTTCTTCGCGTCACCCGTCGACGACGCTATCATGCCGTGGGAGAGCTGCCTCTTCGGGCGCTACA
GCGAGGTGGACACGCTCGACGAAATCGAGACCAGCTTCATGAACTTGATCATTGTCAACATAACAGACACGCACGAGTACAGGGAGGACACGTTCGGAAT
GCGCACACTGGATGAGCGCGGTGGCCTGCACCTCCATATCGCTCCCATCGTGACGCACAGTTGCTGGTGCGTCGACGAGAAATACTGCAAGTGGGCTCCC
GTGTACGACGAGTACATCTACCCGGCTTTGAATTGAGCTTCGACTTTTGAAGGGGGCGGGCAGATAAAGTAAACGATGTTAGTGAGGACTCACGTTGGAC
CACACAAAAGCTGAAGGCCGACCCGGATTGAAGCCTGGCGACACTACAACGAACGTGGCAACAAAACACACTGAGTGTCTTGGATGCCACTTCATTATTG
ACAGCGGGATTCCCCGGCGAAATATGATGCCTCATACTGCTCGGAAATGTCACTCTTGGACAAACGTTTCCTGCGGAGGCACTAGGGCATTCTTGATGGA
GTAACAACCGTGCCTCCACCACAGCCAATCACTACTGCCGCTGTGCCATCGGCTCCCGCACAAGCTTCCTCTGGAACGGCCATCCCACAATCCCTCAGTC
CCTTGAGCCAAGAAGACTTTGAGTTGGTGCTAGCGCGCATGTGGGTCATTTATGCCTTGCCGTCCATTCTGATTGAAGCACCAATTGTGCGCCTGTTGTT
CTCCCGGTTGGCTACCCATTTAAGACTGCCGTTCAGGTCCTGCTGATATCAGTTTGTGACGAAATCCAAGCCACAGTCATCGCGATTATCAGGAAAACAG
GCGTAGTGAAACTCGTGACTGATGCTTATACTGACGCCAATAAGTCGAACATCATCCATTTTATGGTGACTGGTCCAGGCATGAAATCATTCTACTGGTC
GTCGCTGCATACGGGGACGGCGCAGCACACAGCGGAATACTTGGCGATAGAACTGGAACGGGTGATTAATGATATTCAGACGAAGACGGGAGCAATGGTG
ACAACAGTGCTGACCGATAATGCCAGCAATATGTCTGGCGCTTGGGCAATTTTGGAGAGGAGGCTACCTGTGTTTGGTGGTGGTTGTCTGCTCACGGTCT
CAACCTCGTGTTGGAGGAGGTGTTCTCGAAGATCCCCTTCGTTACTGACCTGAAAAGTACAAATTTGCCCGATTGGTTCGAGACCATCATGGGCTTCTGG
AGTAGTTCAGAAATTTGCAAGAGTCCATGGTGGAGAGGCTTCAAAAGGAAGGCACCGTGCCTCAGCAATTCCTGACCCACCCGATGGTATTCCCAGCACT
CCTGTCTTAAGAGCGTATTGACAAACCTCGAGCCTTCCTCTTGGACCCAAACACTGACACGTCGCAGTTCGTTGATTCGGATGAGGCGGCGGGCACTGTT
GGAGCAATGAAGATAAGGCGGAGTGTGCAGGGGCGAGACCACAGAGCTGGTGAAAAGTCAATGCGAACAAGAACGAGATGTATCGAGCGATCTCGCACCT
TGCGGATATTGTGTTCTCTATTTCGACTTCATCGGCAGCAAGTGAAAGGGCTTGGAGTATTATGGACTTGGTGGTATGCTTTCCGACAACAAGATTGATC
TCGCGCATCCCGAGTCGGGAGTGGAGGATACCAAAGTGATCCAACACCAAGACTTGATGTCGATTTGAGAACAGTGTCTCCGTTAAACCTCGTAGCTAGC
GAGACATCCATAAGTTTATGAATTCATGACGTATGCATGCTTTTTCCTATTGTTCATTCTCTCATTGCGTCGCGCGTTCTGGGTTATGTTGGTTGTGCGG
CCAAATTAATAGGAACAAGTTCGGAAACGATCCGAGCAAACCTTCGGAAAGTGTTCGCAACCAGCACTATTCTCAGTTGGGCAAATCGAGCTACGCTCCC
ACGTCTACGGTCCAGAATGTTTTACCGCGTGCGAGATCTAGCAAGAAGTGCTCTCGATGTGGTTTGACAACGAATTGCTCGTCCTCACTTCCAATGGAAA
CTACATGGCTTCGTTTATCACATGGATTATCCAAGAACGTCGGCCGACGTTCTAGCTTCCTGCTTATTATTATTAGAGAGTAGACGACCGCGGCCAAACC
GGGAGAAGGGTGGTTGGTTATTGTTTCCACGGCACAACCGCAGCCTTCAGATTGTCGACCACACGGTGTCCATGCTGGCTAAGCAGCCGTCACGGCTGGG
CCCGCACCACTCGATGGAAACCATGGAGACCGCAGGCAAGTTCGAGCCCTTTCGGTTGATCCATCGCCTGCTGGTGTTCGCTATCGCGCTGTGGTACGTG
GCCATCTCGGCGCAGGCCTTCGTGGCTGCAGTCACAGTGCTGCGAGGCCTCGAGTCGAAGGATCTAGGTGTAACCGTGTACACGTCCAAGCTCATTGCAG
GTTATGCTGGCGAGACCACTATCCACGACAGTCCATTGGTGCAGAACGTGTTGGGAGGGTCAACCGAACCCCGGGACGACGCGATTTATCTCGAGACGGA
TACCTCCGTCTCGTTCACAGGATGCTCAACTTTTGAAGGTGCAGACAGCAGCGTCTACAGCAACGGCTTTACTCGGCTGCTGTTCACCTCTTTGCAGAAG
CACGCGAGGGGAAATCTCTCGTACGTCGAGGAGCTCGAACTCATCGCACCAGTTGTAGACTGCACGTTTGAGCTGCTGGTTTCGGCCGACGAAGAGGTGA
CAAAGCTGCGGATGTACTATTTGGCGCGCCAGAAAAGAAATGCCAGCGAGGTGCTGCTACTGTCGGCGTTGATGTCGACGCAGGATTTCCAGGTGAGCCA
GCAGTATCAAAGTGGGGCCGCGTTGCTAGCCTCAATTGCGGCCATTGAGGACATGCGCGCCACCGAAGTTGTGCACCACTTTGCCATGGCCTACAATTAC
CCCTACGAGGATGAACCCCATTTCGCTGTCAGTGAGCTAATTGGCGTCGAAGAAGACAACTTCTGGCTGTTCAAGAGCCAACCCAATGAGGGAAGCATCG
ACCCGGTAAAAGAAGTACGTTCGGCGTATCGCTTCGGGGGCTACATTGACGACCCGGTGGCTCAGTCCAACGTTGAAATCGTGCACTGGAATCTGCAAGC
CGATCCTGCTTCGGAGCTAAGCAACTGGGAATGGCATTCGCTTGCTTCTCTGCACGACTCATGGGCCTGGACACACACGATTCACGGTATTTTCGCAATG
GATGTATTCTTCGATCTGGAGATTCTCTTCTTCGTGATCTACCACCGCGCTCGAAAGGGCCACTTCTGGGTGGGCGACGCGTTTGCCACCATTTCCAATG
CACTACTATATCGTGGCGTGCTGATCTTCGCCGCGAACCATCTCAACGGGTACTGGACGCTTACAGAGTTCTGCCTCGCGATCGGCAACGAGGTTGCCGG
GCGCCGATCGATTCATTACCGCCCCGAGATGGTACACGCTGATCTACTAACGTTCTTCATGAACGTGGCCAGCATTTTGAGCTACCTGTTTCGGGAGCGA
ATCGACCCAGTACTGGCATGCACCGCGTTCGAATTCGGCTTTGCGTACCGAGTCGAAATCGTCAGTGGCATGTCCTCACTAAGAAATGTTGTCGCCGGCT
TTGCGGAGAAGGATCACTGGCTTGGACTCATTAATGTTAGTCCGTTCCTCACGAGGTTATCGCCCATGAAGTTCTGGACGGTGCATGAGATCAAGACTGA
CCGCAAACCCGTCGTGATTGCCACCGTGCTCTCCATCTTCAGCATGATACTTTGGCTGGTGCTGTACATCATCGCTCGCAAGGCTTACCGCTACTGTAAG
CGCAAGCACGATGGCGCTAATCACCGAGCCAGCCGCTACGCCTCCAAAGAATACGGGTCGGAGGGAGAAGACGGTCTCACGTCGTTCGAGTCAGCCACGG
GGTCGGCTCTGAGCAAGCGCTATGGCGTCATCTCCGGCTACGACAATTACGTCGTTCGCAACGACAAGCGCTATGCATCCATTGATGCCGTATACGGCAA
CGGGTTTCTCGTCGCAAATGGTAAGTTCCTCCTTTCAACGGAGGATATTTTCTCGCTGTTGGTCATGAAGGTCACGCGTGTGCGCTTCACGAACATCTAC
GTGTACGCGATCCTGGCGGACGGCGCCGTGAACCAGACAGCTCAGCTCGTATACCCTCACACGATCCCATGGGACGACTTTGGTCGAATTGGTGTCGCCA
AACTCTCGTAACAGGCAGCGAACAGGTATGTAGGGCCTGTCAGTGTAAATGGTGAAGCACAACCCCATATCGCCGCGTGAGGATGTCGATGCGCGCCCGG
ACATCCTTCACTGAAAGCCATCAAGAGAGCGTTTCCTGCTCGACTACAGACGTCTTTGGACAGAGAACACCACTTAACGGCAATCGACACGTTCATTTTC
TGTTGTCATCGCAGTGTCATCGACCAGCCTGCCAAACCAGAGGCACAAGGGTCGATGAATGCGTGTGTGAAAGAACACTTCCCCACACGCCCTACCTCTG
TCTGTACACCTCTTGCTCTGACTCAGCTGCCCTTGGTGCCGCCCTGTATGGTACTTATTTGATAGGCTTGCGCTCGAGGGGCTCACCCTTCAGCACCTTC
TCAATTTCAGCACCCGACAGCGTCTCGTACTCTAGCAGTGCCTGGGCCAGCTTCTCCAGGTCTCCGTGCTTACTTACAAGGATATCCTTCGCGCGCGTGT
AGGACGCGTCGCACAGCTTCTTCACTTCATCGTCGATGGTCTTGCGCGTGGTGGCGCTCGTATCGTTGCCACGGAGGTCGTGGAAAACAAGACCCACGTC
CGAGCTCATGCCGTACTTGGTCACCATCGTACGAGCAACATTCGTGGCCTGCTGGATGTCAGACGACGCGCCTCCCGTGATCTCTTCCTCGCCGAATGTC
AGTTCCTCCGCCACGCGGCCGCCCATACACACATCCAGCCGTGCCAGCAGTTGCTTGCGTGAAATGGACGTCTGGTCACCCTCCGGCAGCTGTGAGACCA
TGCCCAATGCCTGGCCGCGCGGCATAATGGTCGCCTTATACACGGGGTGAGCTCCTGGAGTGTTAATAGCTACCAGCGCGTGGCCTCCCTCGTGGTAAGC
AGTAAGCTTGGCCGAGTCGGGTGTGATCAGCGCCGACCTGCGCTCCGCGCCCATGAGGATCTTGTCCTTGGCGTATTCGAAGGCATCCATATCCACCACA
TCAGCACTCTTCATGGACGCGCGCAGAGCAGCCTCGTTCACGAGATTGGACAGCTCCGCACCAGACATGCCGGGCGTCGCACGCGCGAGCACGTCCACGT
CCACATCGTCTCCAAGAGGGATCTTTCCAGCATAGAACTCCAGGATCTCCTTGCGGCCAGCGACGTCGGGCAGATCCACCGTCACATGACGGTCAAAGCG
ACCTGGACGGATGAGCGCGTTGTCCAGCACGTCGGGGAAGTTGGTGGCGCCGATCACGATTATACCCTTGTTCTGGTCGAAGCCGTCCATCTCCACGAGG
AGCTGGTTGAGCGTCATCTTCATGGCCTGCTGCTCCTTGAGTTTGCGCGTGCCGCCGATCGCGTCGATCTCGTCGATGAAGATGATGCACGGAGCCTTCC
GCTTGGCCGACTCGAACAGGTCGCGCACGCGGCGCGCGCCCACACCTACATACATCTCCTCGAACTCGGAGCCCGACGAGTAGAAGAAGGGCACACCGGC
CTCGCCGGCAATGGCACGGGCCAGCAGCGTCTTGCCCGTGCCTGGTGGGCCGGTGAGCAGCACGCCCTTGGGCAGGTTTCCTCCGAGCCGCGTGAAGCGG
GCCGGGTCTTTCAGGAACTGCACGATCTCCTCGAGCTCCTGTTTGGCCTCAGTGGCCCCCTTGACGTCGCTGAAGCGCTTGTCGCTGCCGGTGGGGCCCA
TGACCTTGGAGGCCGAGCCAATCTTGCCCACCTTCTCGTCCAGCATGGCCCCGAGGGCAGAGACCACGAGGAAGGCCACGCCCAGCGTGCGCAGCGTTTT
CCACATGTTACTCTTGAAGCTGCCTTCCACCATGGACACGAAGACCGGGTCGTGGGCCGACTGGCCCTGGCCATTGCGGGCCGCGGCCTGACTGGCGGCG
GCCACGCCTCAAACTGTCGGGCCGCGCAACCGTGCCATAGGCCTGCTCGACCGGCTGGGCCAGCTGCGGAAGGTCGACCGTATCCAAGCGGCCCGTCTTG
ACCAGGGCCTTGATATACTCCTTCTGCACGGCTTCGTCCAGCGCGAAGCGGTTCTCCTCCACGCGACGCACCACGAGGGCCGGGTAGTTGCTGCGGTTCA
GCTCCTGCAGGAAGCGCAGCTGCGCGTACGCGTCCTCGGGGCTGGAGTTGGCCGCCTGCTCCAGCGACTTGAGCTGCTTGAGCTTCCCGCGCTGCGTCAT
GTTGAACAGCGAGCGCTTGGCGCCGGCGGACGGTACCGGCCGAGCGAAGGCCGGGGCGGGCCACGCACGCGCAGGCGTCGACAGCACACTGGCGCGACTG
GCTGCGCGCTGAAGGAGCAGCAGGCTTCTTGGCCGCAGGACGAGCATGAGGGCTTCTGGCTAGGCTGCGTGTTTTCTAATGAGCGTACAATTGTGTGTAC
AAACACCACTATGGTGTGTGCCACTACGATTTGAGGAATGACGGTCTGCCGTTTGCCCCGTCACCAGAGGCAAGCACCCGCAGTACGATACGTTCGCTAA
CGGTGGTGGCGGCGAGTCCAAGCAAAGGCTGCAGGACGCAGCATTCCAGACGCTGACATCTGCAAACTACTGGCGGAGAAGGCCGTGGTGCTGGCGGCGA
ACAGTGCCGATATCATTGCGAGCGAGGCGGCGAACCGGAAGGTACTGGTAGAAGGTGGGAAGCTGGCAGCTACTCGATACGACGGTGCAATACCAGGAGA
CTTGTACTCGCTGGCAGCATCTCCTACAGGATTATGCTAGTTATGATGGCGAGAACCAAGCAGCCAAGGACAGAGACGTTGACCGACTTGTCGACGAGGA
GGAACGGGAAGAGGGTCGCGTGTCGAAGGAGCAGTTCTCCAACTACCTTGACTCGCTGGGAGGCATGAAGGTGTACATTTTCCTGATCGTGGTGCAGACG
CTG