Description :
From Genome Similarity Track
Location :
contig_134:43007- 45658
Transcript NameFunction/comments
g14191.t1hypothetical protein

Sequence
2651 bases(100 bases per row)
CCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTC
CATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCC
GTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTT
TTGAATTAACCGGATATCCCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTG
TGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGT
CAACCACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGC
CAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTT
TGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAG
ACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGG
CATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAATATGTCTTCTCACGGCCAGGATG
TCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAACTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTG
TAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGAGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACT
CCAACAACTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACGTCATCCAACAAGGACGACGAGGGTGTAGTCGTCCTCTTGCACCGCATAATCTG
GTCGACGCGAAAGCGCGTCGGCCACGACATTTAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCT
TTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCG
AGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACTGGGTAATTGCGCTCGGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGAC
CTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGG
CGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAGGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGA
ATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGA
TCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTT
TGCATAGAGCTTGTGCTTTCGCATCTCCACATCCGATCTCCCATACACAGCCCGGCTGTGAATGAACACATCATCGAAATAGCTCGGTGCAAGTCGCGCA
CCGAGCGCAGCAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGTGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGT
GCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAA
TCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCGTCGTTCAGCTTGTTATACGCATGAACGATGCGCCACCCTCCCTGTGGCT
TCTTGACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCACACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTG
CTCACGCGGCAGTGGCCACTGCCGCGTGACGCAATACTTCGTTCCCGACACGAGATCAATCTCGTGCTGGACACCCTTGTCCTGCGGTAATTCCGCAGGA
ATATCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGAT