Description :
From Genome Similarity Track
Location :
contig_17:430044- 437775
Transcript NameFunction/comments
g4081.t1hypothetical protein PHYSODRAFT_472012
g4082.t1cell division protease ftsH

Sequence
7731 bases(100 bases per row)
GAAACGGATGACGTTCGCACACCGAAGCGCCTTTCACCGCGCCAGAAGTGCCCGCATCAACTCTTCTGCGCCTCTGTGAGTTTGGTGGGGAACTGCACGT
CGAACTCCACCACGAGGTTACCTCGTTGCGAGGGTCTCTTCTGCAGCGGCATGTCCTCACTGAGGACATGCCGCTGCAAGAGACCTCCTCACCCGCGATC
AGGTGAGATCGTCACGGTGTCACTGCGTCCAAGCCTCTCGGATTTGCTTTCGAATTGCGAGGAAACCCCAAGCCGACCCGCGACTGCTTTACCACGTCTC
CAAGGACACAAGCGCCGCATTTCACGAAAAGAGCAGATGCACGACCTCCGCAATACTGTGTCGGAGCTATGAACGAAGCTGGAAGGTCTGCGGGCAGAGT
CTTGGATGTGTTCGCCCATGGCATCTCCTGTATCTTGCGCCGCAAGTCAGCATGCGACCGCTCGCCAGCTCATACTGCGTTGCAAAGCAGAAGAAGAGAA
CGCCAAATTGCAGGAATTACTGGCATCGCAGAGACGCACGGCCCGCAACATCAGACGCTTGCTCCGACGGGAGCCGGTGACGAGGTAAACGTTGTTGCGC
TGGTTTTTGCTAGTTTTGATGGCTAACAGATTCATTTGCTGAAACTCGTTATTTTGCGTCTGTAGCTGCTAGAAGTGATACACAACTCGAAGCGCTTGAA
GTTTGACAACAACGAGCAGGTTTTCCATGAGCTCCTACACGGAATTGATACGATTTACGTGGATTTTGGCAAGCTGTACGAAGTAAAATGGATGCCAGCA
GTTCCATGCCCTGGGCGGAAGCGCCGAACGGACCCCAATGCCGCCGGCGGTGATGTTTTCGTTGAGTTTGTCGACAAGAACCAAGTCCCCTTCGATTTTC
AGAGAAGTGAGCGCGCAGTGTGGAAATTTCTGCAGGGCCCGCGGGTTCATGACGGAGGTCGTGCCTAGTAGATGTAGCTTCAGAGGCTGCTCGTTTTTGC
CCTTCACTCACACTGTTGTTTGTTTGCTTTGTGGGATCAGGAATTTCAGCAAACTACCGAAACAAGCAAGAGTTGTGTGAGGCCATTCTCGATTTTACTG
GCTTCGGCTCAAGTCTCCCAACAACTTCCAACATGGTCCGCACCCTGTCGGTTCTAGTGTCTAGCGCAATTGCCCAGGCAGGCATTACCTCGACGTCCTC
GAAGCTCCCGGTCATTTTCTTCCACGGTGTTACCACAACGTGGCAGTTTGGCCACAACTTTGCTGCAAATCTCACTGCTGAAGGACGTGAGGTCGTGTCA
CTCTCATTCTGGGACGCCCAGTGCTCCATTGAGTCGCTCCTGATCCAAATCCCTGAGGCCGTGAAGGCCGTCCGCAACACGGTTGCCAACAACTCGGTAT
TTGACGATGGATACATGATCATCGGACACTCGCAAAGAGGGATTATCACCCGTGCCACAATCGAAGAAATGGACGACCACAAAGCCAAACGCTTCATCAG
TCTCGATGGTCTCCAAAACGGACAGTTCATCGGACACAACGCGGTCGATATCGCCATCGAAAAGGGTGCGCCATCCCTCACTAACATCGTCCCGGAACGC
GTGTTCAACTATACCAAGTATGTGCCGAAGGACTACTACGGCAAGATGCAGAAGGACTTCACCATCTTCTCCATCGAAAACCCGGACACTCAGTACGAGT
ACGCCCAATTCAACGTCCAGCGCTGGCCCCAGTTCGGAAGCTGGTCCATCACGAACAAGCTCCTGCCTGTGTACAACAACGTGAACCCGTGTCCCCCTGG
CAACGACCAGTGCATCAGTGACCAGCAGCGTCGCCGAGCCAACTTCCTCAAACTCGAAGAAGCCCACTTCTTCGCGTCACCCGTCGACGACGCTATCATG
CCGTGGGAGAGCTGCCTCTTCGGGCGCTACAGCGAGGTGGACACGCTCGACGAAATCGAGACCAGCTTCATGAACTTGATCATTGTCAACATAACAGACA
CGCACGAGTACAGGGAGGACACGTTCGGAATGCGCACACTGGATGAGCGCGGTGGCCTGCACCTCCATATCGCTCCCATCGTGACGCACAGTTGCTGGTG
CGTCGACGAGAAATACTGCAAGTGGGCTCCCGTGTACGACGAGTACATCTACCCGGCTTTGAATTGAGCTTCGACTTTTGAAGGGGGCGGGCAGATAAAG
TAAACGATGTTAGTGAGGACTCACGTTGGACCACACAAAAGCTGAAGGCCGACCCGGATTGAAGCCTGGCGACACTACAACGAACGTGGCAACAAAACAC
ACTGAGTGTCTTGGATGCCACTTCATTATTGACAGCGGGATTCCCCGGCGAAATATGATGCCTCATACTGCTCGGAAATGTCACTCTTGGACAAACGTTT
CCTGCGGAGGCACTAGGGCATTCTTGATGGAGTAACAACCGTGCCTCCACCACAGCCAATCACTACTGCCGCTGTGCCATCGGCTCCCGCACAAGCTTCC
TCTGGAACGGCCATCCCACAATCCCTCAGTCCCTTGAGCCAAGAAGACTTTGAGTTGGTGCTAGCGCGCATGTGGGTCATTTATGCCTTGCCGTCCATTC
TGATTGAAGCACCAATTGTGCGCCTGTTGTTCTCCCGGTTGGCTACCCATTTAAGACTGCCGTTCAGGTCCTGCTGATATCAGTTTGTGACGAAATCCAA
GCCACAGTCATCGCGATTATCAGGAAAACAGGCGTAGTGAAACTCGTGACTGATGCTTATACTGACGCCAATAAGTCGAACATCATCCATTTTATGGTGA
CTGGTCCAGGCATGAAATCATTCTACTGGTCGTCGCTGCATACGGGGACGGCGCAGCACACAGCGGAATACTTGGCGATAGAACTGGAACGGGTGATTAA
TGATATTCAGACGAAGACGGGAGCAATGGTGACAACAGTGCTGACCGATAATGCCAGCAATATGTCTGGCGCTTGGGCAATTTTGGAGAGGAGGCTACCT
GTGTTTGGTGGTGGTTGTCTGCTCACGGTCTCAACCTCGTGTTGGAGGAGGTGTTCTCGAAGATCCCCTTCGTTACTGACCTGAAAAGTACAAATTTGCC
CGATTGGTTCGAGACCATCATGGGCTTCTGGAGTAGTTCAGAAATTTGCAAGAGTCCATGGTGGAGAGGCTTCAAAAGGAAGGCACCGTGCCTCAGCAAT
TCCTGACCCACCCGATGGTATTCCCAGCACTCCTGTCTTAAGAGCGTATTGACAAACCTCGAGCCTTCCTCTTGGACCCAAACACTGACACGTCGCAGTT
CGTTGATTCGGATGAGGCGGCGGGCACTGTTGGAGCAATGAAGATAAGGCGGAGTGTGCAGGGGCGAGACCACAGAGCTGGTGAAAAGTCAATGCGAACA
AGAACGAGATGTATCGAGCGATCTCGCACCTTGCGGATATTGTGTTCTCTATTTCGACTTCATCGGCAGCAAGTGAAAGGGCTTGGAGTATTATGGACTT
GGTGGTATGCTTTCCGACAACAAGATTGATCTCGCGCATCCCGAGTCGGGAGTGGAGGATACCAAAGTGATCCAACACCAAGACTTGATGTCGATTTGAG
AACAGTGTCTCCGTTAAACCTCGTAGCTAGCGAGACATCCATAAGTTTATGAATTCATGACGTATGCATGCTTTTTCCTATTGTTCATTCTCTCATTGCG
TCGCGCGTTCTGGGTTATGTTGGTTGTGCGGCCAAATTAATAGGAACAAGTTCGGAAACGATCCGAGCAAACCTTCGGAAAGTGTTCGCAACCAGCACTA
TTCTCAGTTGGGCAAATCGAGCTACGCTCCCACGTCTACGGTCCAGAATGTTTTACCGCGTGCGAGATCTAGCAAGAAGTGCTCTCGATGTGGTTTGACA
ACGAATTGCTCGTCCTCACTTCCAATGGAAACTACATGGCTTCGTTTATCACATGGATTATCCAAGAACGTCGGCCGACGTTCTAGCTTCCTGCTTATTA
TTATTAGAGAGTAGACGACCGCGGCCAAACCGGGAGAAGGGTGGTTGGTTATTGTTTCCACGGCACAACCGCAGCCTTCAGATTGTCGACCACACGGTGT
CCATGCTGGCTAAGCAGCCGTCACGGCTGGGCCCGCACCACTCGATGGAAACCATGGAGACCGCAGGCAAGTTCGAGCCCTTTCGGTTGATCCATCGCCT
GCTGGTGTTCGCTATCGCGCTGTGGTACGTGGCCATCTCGGCGCAGGCCTTCGTGGCTGCAGTCACAGTGCTGCGAGGCCTCGAGTCGAAGGATCTAGGT
GTAACCGTGTACACGTCCAAGCTCATTGCAGGTTATGCTGGCGAGACCACTATCCACGACAGTCCATTGGTGCAGAACGTGTTGGGAGGGTCAACCGAAC
CCCGGGACGACGCGATTTATCTCGAGACGGATACCTCCGTCTCGTTCACAGGATGCTCAACTTTTGAAGGTGCAGACAGCAGCGTCTACAGCAACGGCTT
TACTCGGCTGCTGTTCACCTCTTTGCAGAAGCACGCGAGGGGAAATCTCTCGTACGTCGAGGAGCTCGAACTCATCGCACCAGTTGTAGACTGCACGTTT
GAGCTGCTGGTTTCGGCCGACGAAGAGGTGACAAAGCTGCGGATGTACTATTTGGCGCGCCAGAAAAGAAATGCCAGCGAGGTGCTGCTACTGTCGGCGT
TGATGTCGACGCAGGATTTCCAGGTGAGCCAGCAGTATCAAAGTGGGGCCGCGTTGCTAGCCTCAATTGCGGCCATTGAGGACATGCGCGCCACCGAAGT
TGTGCACCACTTTGCCATGGCCTACAATTACCCCTACGAGGATGAACCCCATTTCGCTGTCAGTGAGCTAATTGGCGTCGAAGAAGACAACTTCTGGCTG
TTCAAGAGCCAACCCAATGAGGGAAGCATCGACCCGGTAAAAGAAGTACGTTCGGCGTATCGCTTCGGGGGCTACATTGACGACCCGGTGGCTCAGTCCA
ACGTTGAAATCGTGCACTGGAATCTGCAAGCCGATCCTGCTTCGGAGCTAAGCAACTGGGAATGGCATTCGCTTGCTTCTCTGCACGACTCATGGGCCTG
GACACACACGATTCACGGTATTTTCGCAATGGATGTATTCTTCGATCTGGAGATTCTCTTCTTCGTGATCTACCACCGCGCTCGAAAGGGCCACTTCTGG
TGGGCGACGCGTTTGCCACCATTTCCAATGCACTACTATATCGTGGCGTGCTGATCTTCGCCGCGAACCATCTCAACGGGTACTGGACGCTTACAGAGTT
CTGCCTCGCGATCGGCAACGAGGTTGCCGGGCGCCGATCGATTCATTACCGCCCCGAGATGGTACACGCTGATCTACTAACGTTCTTCATGAACGTGGCC
AGCATTTTGAGCTACCTGTTTCGGGAGCGAATCGACCCAGTACTGGCATGCACCGCGTTCGAATTCGGCTTTGCGTACCGAGTCGAAATCGTCAGTGGCA
TGTCCTCACTAAGAAATGTTGTCGCCGGCTTTGCGGAGAAGGATCACTGGCTTGGACTCATTAATGTTAGTCCGTTCCTCACGAGGTTATCGCCCATGAA
GTTCTGGACGGTGCATGAGATCAAGACTGACCGCAAACCCGTCGTGATTGCCACCGTGCTCTCCATCTTCAGCATGATACTTTGGCTGGTGCTGTACATC
ATCGCTCGCAAGGCTTACCGCTACTGTAAGCGCAAGCACGATGGCGCTAATCACCGAGCCAGCCGCTACGCCTCCAAAGAATACGGGTCGGAGGGAGAAG
ACGGTCTCACGTCGTTCGAGTCAGCCACGGGGTCGGCTCTGAGCAAGCGCTATGGCGTCATCTCCGGCTACGACAATTACGTCGTTCGCAACGACAAGCG
CTATGCATCCATTGATGCCGTATACGGCAACGGGTTTCTCGTCGCAAATGGTAAGTTCCTCCTTTCAACGGAGGATATTTTCTCGCTGTTGGTCATGAAG
GTCACGCGTGTGCGCTTCACGAACATCTACGTGTACGCGATCCTGGCGGACGGCGCCGTGAACCAGACAGCTCAGCTCGTATACCCTCACACGATCCCAT
GGGACGACTTTGGTCGAATTGGTGTCGCCAAACTCTCGTAACAGGCAGCGAACAGGTATGTAGGGCCTGTCAGTGTAAATGGTGAAGCACAACCCCATAT
CGCCGCGTGAGGATGTCGATGCGCGCCCGGACATCCTTCACTGAAAGCCATCAAGAGAGCGTTTCCTGCTCGACTACAGACGTCTTTGGACAGAGAACAC
CACTTAACGGCAATCGACACGTTCATTTTCTGTTGTCATCGCAGTGTCATCGACCAGCCTGCCAAACCAGAGGCACAAGGGTCGATGAATGCGTGTGTGA
AAGAACACTTCCCCACACGCCCTACCTCTGTCTGTACACCTCTTGCTCTGACTCAGCTGCCCTTGGTGCCGCCCTGTATGGTACTTATTTGATAGGCTTG
CGCTCGAGGGGCTCACCCTTCAGCACCTTCTCAATTTCAGCACCCGACAGCGTCTCGTACTCTAGCAGTGCCTGGGCCAGCTTCTCCAGGTCTCCGTGCT
TACTTACAAGGATATCCTTCGCGCGCGTGTAGGACGCGTCGCACAGCTTCTTCACTTCATCGTCGATGGTCTTGCGCGTGGTGGCGCTCGTATCGTTGCC
ACGGAGGTCGTGGAAAACAAGACCCACGTCCGAGCTCATGCCGTACTTGGTCACCATCGTACGAGCAACATTCGTGGCCTGCTGGATGTCAGACGACGCG
CCTCCCGTGATCTCTTCCTCGCCGAATGTCAGTTCCTCCGCCACGCGGCCGCCCATACACACATCCAGCCGTGCCAGCAGTTGCTTGCGTGAAATGGACG
TCTGGTCACCCTCCGGCAGCTGTGAGACCATGCCCAATGCCTGGCCGCGCGGCATAATGGTCGCCTTATACACGGGGTGAGCTCCTGGAGTGTTAATAGC
TACCAGCGCGTGGCCTCCCTCGTGGTAAGCAGTAAGCTTGGCCGAGTCGGGTGTGATCAGCGCCGACCTGCGCTCCGCGCCATGAGGACTTGTCCTTGGC
GTATTCGAAGGCATCCATATCCACCACATCAGCACTCTTCATGGACGCGCGCAGAGCAGCCTCGTTCACGAGATTGGACAGCTCCGCACCAGACATGCCG
GGCGTCGCACGCGCGAGCACGTCCACGTCCACATCGTCTCCAAGAGGGATCTTTCCAGCATAGAACTCCAGGATCTCCTTGCGGCCAGCGACGTCGGGCA
GATCCACCGTCACATGACGGTCAAAGCGACCTGGACGGATGAGCGCGTTGTCCAGCACGTCGGGGAAGTTGGTGGCGCCGATCACGATTATACCCTTGTT
CTGGTCGAAGCCGTCCATCTCCACGAGGAGCTGGTTGAGCGTCATCTTCATGGCCTGCTGCTCCTTGAGTTTGCGCGTGCCGCCGATCGCGTCGATCTCG
TCGATGAAGATGATGCACGGAGCCTTCCGCTTGGCCGACTCGAACAGGTCGCGCACGCGGCGCGCGCCCACACCTACATACATCTCCTCGAACTCGGAGC
CCGACGAGTAGAAGAAGGGCACACCGGCCTCGCCGGCAATGGCACGGGCCAGAAGCGTCTTGCCCGTGCCTGGTGGGCCGGTGAGCAGCACGCCCTTGGG
CAGGTTTCCTCCGAGCCGCGTGAAGCGGGCC