Description :
From Genome Similarity Track
Location :
Scaffold_105:430- 6942
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_105-snap-gene-0.2950S ribosomal protein L4
Pytir_DAOMBR486maker-pir_contig_105-fgenesh-gene-0.1Protein pianissimo A

Sequence
6512 bases(100 bases per row)
TACTCGGTGTGCAGGCGCTCCTCCAAGTACTTGACCGCGTCTTTTGTGATGACGAGCAGGTCCTTCTGCAGGATCGAGTAGACGTTGATCTTGTGCTGCG
GGAGGGTGTCAACGTACGGGATGTTGCGCGTCGAGAGCAGGAAGTTGGTGGTGACTTCCTCGCTGTCGATGAAGAGCGCGTGGTCCCAACCGCGCGACTC
CAAGAACTGCTTCATGTCCTTCGTCTTGGAGCTCTGTGGGATTTGCCAGCACGAGGTAGCAAACGTATATTAGCACTCCGCCATTGAGATAGATAGATCA
TAATGGCATAGGCATGCCATAGTATAGCAACATACCTCAATGTCGAGCGAGTCGACGATCGCGAGCTTGCCTTCGCGGAGCTTAGTGGAGAGAGCGACAC
GGAGACCCATGGCGCGCACCTTCTTCGGCAGCGAGTACGAGAAGTCGCGGAGCTTTGGGCCGTGCACGCGGTAACCACCACGCCACTGCGGCGCGCGGAT
ATCACCGACACGGGCGCGGCCCGAACCTTTTTGCTTCCATGGCTTTCTCGTCGAGCCGCTCACTTCCGTGCGGGTCTTGGTCTTGTTCGTACCGGCACGG
CGGCATGCCAACTGCCATCGCACGACACGCTGCAAGATGTCGACGCGGGTCGGCGCGCCGAACACGTTTCCGCTGAGCGTCACTGGCTCGAGTTCGTCCT
CGGACTTCAAGCTCAGCAAGTTGATCTGCACGTCGCCCTTTTCAGTGAACGTCACTGTTGTTGTTACGAGACACACAAATATTGGAGTGAATACGAGAGA
TGAGCGAATAAGCACCATGGGTAGCAGAAACACTAGAGAATGCAGAAGAACAGCTGGTGCCACTGCATCTACAGCAACGATGAAAGGAACACAGCGCGCG
CGTACCTTTCTGCGCGGTCGGGATCACGCGAGGCGCGCGCATTGGCTTCTCGTCCGCGAACACGATGTTCGCTGGGATCTCCACGGCCGGCGCCGCCTGA
GAGCTCATGGTGCGCGCGAGGAGCGCGGAGCGGGGCGTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCGGTTCAGCGCGAACGACATG
TCTGCAGCAGCACGATGATCTCTCGTTCCTTCTGCGCTGCGAGGCTTCCTGTCAATTGCTCCAGCAGACCGACCAAGCCAGCCAGCAGCAGCCACTCGCG
GCCACACAGCCCATCTGCATAGTGAAAATAATGGGGTCAACCCAATTACCTGGATCCCGAATGACCCGATAGTCAGCAAAAACCCATAAACCCATAAAAT
GCTCAATTCAATTCATTTATGAATTGAATTGACGGAAAATGGTTTTGTCGGGGTTACGACCTTGCGATTCAAAAACGAATTGTGCTTATCAACTGTATCG
GAAAAAAATGTGTCCAAAAAGAATCCCATCTGCGAATCACGAAGTGGCGAAAGAAAGCGCGAGTTGCTCCGCACTTTTCAGCGTCTCTGCGTGTGAGGAA
GCAAGAGTGAGCGACCGGCAGGTGCACGCGCGAACTTCGACACAGAGAGAGATGGCGCGACGGATATCCCTAATGCCCAAGTCGACGGACTCGAGCAGCC
TCGGCGCGATCTGCACGCTCATTGAGCGTGGGAACCTGGACCGCAAGTCCAAGCTGGAGAGCGTCGGCCGCATTTGCCATGTACGTGAGTTGCTTGTGGC
GAGCTTTGCTTGCTCCTGGTCCATCGACATATTTTTGTGGGGACGTCAGTTGCGTCAGGATACTGGTGTCCTCGAGCAATCGGGCTGGCTATGAGCAGAC
TCACTTGGTCCAACACGAAGAAACTCTGCTGCAATCGTCGTAGAGTGTGCTAATAAAATGGGGTTGTATTACAGGAGCTGAAAACAGACCCGCTGCTGCT
GGACAGCTTCCCAATCGACCGGCTGATGAAGTGCATGCGGCGCCTAGTGTGCGACTCCGACACGTCGACGCGTTTGGGGGCACTTCGCGTCCTACGCTAC
ACGATCTGCAGCAATGAAAGTGTGAAGATCCTCATCGATCTGGTACGTGGATAACGATGCCATTGGGAGCTAGTGTTGATGTGGCGTCTCATTATTGTGT
TGTTTGCGTCATTGTCCCCCACAGTGTCTTCCGATTTTTATTGTCCGCGCAATGGAGAGAGAGCAAAAGCTCCTGGCAGAACGCGTGCAAGCCCTTAAGG
TCATCCGTCGTATTATGGAGATCGACGCCGCGCAGATGCCGCCGAGTCTCGTGGCGTCGATCGTTGCGATCGCTGGGCACAAGGACGACAACTTGCGACG
GATCTGCCTGGAGACGCTTCGCGAATTGGCGCTTGCAAATGTCGCGATTGTTGCGGAATGTAATGGCATCAAAGTGATCGTCGACTCGATTCTGGACTCG
TCGTTCCAGGATTTGTCCGATTCGCTCATCTTGACGCTGCTCATGCTACTGAACGAGCCGTCGACGCGCCAGTTCATCGACCCGTTCATCGACACGCAGA
TTCTGCTCGCGCCATTCACAGACACCGATTTGCCAGCAGGCAACGAGCGACGACAGCGATGGATGGCGAGTCGAAACGCGATTGTGACAATGATGCGCTC
GTGGACGGTACGAAATGCTTGCTGTTGTAGTACTATCTGGTGATCGATTGGCACTCCTTTCCTTATCATGCGTCACTTTTGGCCTCTAGGGTATTGTCGT
GCTGACGTCCAATCCGCAAGGTCTCCAGTCGTTGATCCAGCTCTTGGTGCGTCCGGTGGGCGAAGACGTCCAGAAAGCCGTGCTGTCCACGATTTGCGAG
ATTTTCTACAAGAAGACGTCGTTTGACAAGAGCGCGGCGGATGTAGCCGACGTGGTATCGGCCACGATCCCTATCAGCGTGTCCTCGTCCGACGCGATCC
CAGCTCCGATGGGGTACAACCTACTCGACAATTACACTGTGATCGTGCTGCTCGCGATGATCCACTGTGGACTGCTGGACGCGCTGATCACACTCGGCAC
GGGCACGGTGCGGTCACTTGCAGAGCCAGCGATCGACTTGCTGTCCGACATTCTCCGCATGTCGTCGAGACTTCTTCCAGACCAGCACTGCGCATCCTTG
CTCGCCCTACCTCGACTCGTGTCGGCAACTTCGCTGGCATCCATGACGACACAGACGCTCGGAGACCAGGTGAAGAGCTTGCTCGAGCGTTTGCAGCGAG
AGAAATCGATCCGGGCAAGCGAGATGCTTGCGGAGCTTGCGAACGCGGTCGGCGCCAACTCGGGAAGTGTCGCGACGCGGGGGGTGTCGCTTGTCTCCTA
TGGAGGGAGTGGCGTCAATGGTGTCCAGCTGGTGTCTGAGTTGCTGCGCGAGATCAATCGTCCGTCGACTCTGTACTTGCAAATTGGTCGTAGCGCTGGA
AGCAACAACCCGTCGTCGAACTTCTCTTCGACCACGATGAGGCGCCATGGACCGTACTCCGGAAAAGACAACCTGACCTCCCGCGAGCTGATGGTGCAAG
AGCTTAAGCACTCGATGGACGCGCAGATGGACGACGCGACATTCAAAGACATGCTTCACAACCGCTCAAAGATCCTTACTGACAAGAACTTCACCAAGTG
GAACTGGGACGTGATCTCGGAGATGCTAGAAGGACCTCTCACGAACCCTCAGCGGCTCTCGGAGGCGATGAAAACCAAGTTCTTCAAGCGTCTTTCCGGC
TTCTTCCGAGGTGACACGGGCAACAAAGGGTACTTTTCGCTGCTGGACTGGATCCCAGACAATGTCCCGTTCCTCCGCCCTGCGTGTCAGATGTACACGC
TGCTGCTGAACCATCCCGAAGGGCTTTTGTTCCTAAAAACCGATCGCCGTGGGCAGTTGTTGACTGAAATCTCGTCTGCCTTAGAGCTGGAAGCGCGTCC
TGAAGCCGCGATCGTGGAGTCCCACATCGGTATCTTGAAGCAGCGTATGTTCTCGCCCGTCTTTTGCTCCACGAAGATGCTGCGCGAGTATTTCACGCTT
TTGGGACTGATGAGTTCCAGCAAAGAAGGCTTGAAGATGATGGAGCAGTCGAATTTGTTCAACCGCCTGCACGTGATGGGCACGACCAAGGGACACGATT
TCTTGTGCAGGTTGATTCTCGCAAACCTGGACTACTCTGTGGACGGGAGCTCGCGCAAGCTGCTTCAGTCGTGGATGACGGACGGCTCCAAGGCGCTTCG
TCTGTACGCAACGTGTCTGCTTCGAGCGCTTTTGCGTTCCGAAGTGACGGATTTCGCGAAATGGGGCGTCGATGCGCTTGTGACGCAGCTGACCCAGGAA
ACAGAAGTTGCGAAGGCTGCGCTGAGTGTGTTGGAAGAAGCGACAGAGACCGAGGAGTGTTTGCTCGCGATGGTGATCCGACGCCCAACGAAGCTCATTC
AGATGAAGGACAAGCGTGCAGAGTCGCTCTTGCTCAAGTTTTTGTCGCTCCCAGAGGGACTTGCATTCTTGCAAAGCACTGGTGACTGGATCCCGCGAAC
ACTGGTTGCTTGGAGACGAGAGAAGTATGTTTCGTATGTCAATGCGGTTGAGAACTCGCTCTTCCGAGGCTTGCATCGAGACGTCTCAGGCAGAGAGCGA
AGCACGGTGTCCAGCACGGGTAGCATGCGAAGAACGTGCTGGCCGACGCCCATCCCTGTGCAAGTGCCGATGAAGCGTGGCACTGTGAAGAATGGAAGCC
AGCGATCGCTCTGGGGACTCGACTGGTTGTACAAGATGCCGTGGAACATGGAAGTGAAGATTGTCGGGCCTCCTGGGAGCGGGCCGCCGTCGACTCTGAC
GGTGGAAACGTACATTGATGGTTCTCTGCGTGACGAAGAAGACAGCGCTCTGGACGAAGACGATCTGCGGATGAACTCGATTCGAGTGAAGGCGATTGTG
GTCGACGCGCGCAACATGCCGCAGCCTGTGATTGTGAACTCGCAGCAGACACTGCAGGCATGCCTCTTCTTGGGCACGCAGCCTGTGGATCGACGAGGGT
TCACAAAGCCGCCGCCAAAAAGCAACGGAGGATTCGTGATGCCTCCTTCTGTCATTGGCACGGATGCGCAGACGAAGAGCCGCGCACGCTCGACGTCAGC
CGCTGGCAATGATCGTTCGTCCGAGACAAATGCGGCGACGTATGGCTTTCCTGACCCATCGTACCCTGCGTCCGAGTCTGCGGCTGAGGAACACAAAGAC
TGGAGCACGTGCCAGCCTGACCAGCGCTCGTCGCAGTACTTGACCTCGCCAGAGTGCTCGATCTGTGCGCCGGGGGAGCGCGCGGTCTGGAACTTCCGCG
TGGAGATGGACAGCAGCACGGGGAACGTGAAGCGCGTAATGCTCAAGTCTGTCGAGTTCACGTTGCAGCTGTTGCCGCTTCGCCCTCGTTCGGTGCCGCT
GCCTCCTCACTTGTATGGCGAGCTGGGCAAAACGAGCGCAGGGTGCCAGATTCTGCACAACTCTGGTCACATTCCAGAATTCATCGCGTGCCTGCGAGAC
AGTGCAAGTGTTCCACTGGAGAAGCGTGCTGCGCTGTGGGCACTCGGTCACATCGCGGCGACGTCGAGGGGGTACGATCTGATTCACCACTACGCGCACG
ACGTGCTCGACCTGATCGTGAAGCTCACGACAGACTCGCCGCTCGTGTCGATTCGAGGCACGTGCTTCTTCGTTCTCGGTCTCATCTCGCGCTCCACGTC
GGGTCGTCGTAACTTGTCGCGTCTGGGCTGGGACGCAGCGAATGTCTCGCAGTCGTCGATTTCGGTGCCGCAGAACTGCAACTCGCTGTTTGTGTGGCCG
CGACCAACGAACGCGGAGGTCGCGAACAAAATCAGCCCTGTGACGCAGACTCCAACGTCGCCGCTGCAGGCGCTGCTCGCAAAGGTGCCGTCTGAGTGGA
AAGAGGTGCTTCGCTTGGTCGCGGACCTGAGTAACCACATCACGCAGAAAGAAGCGCACTCGTCGCTCAACAGGCTCCGGACGTCCAAGCCCGAGCTCTT
TGAAGAGCCGATGCTGGCGCTCTACATTCACGCGCTGCTGGAGAGATACAATTACCGACTCGCGCTGCGCCAGTTCGTGCTGAACGCGTTCGATCGCGCC
GTGTTGAGCGACGAAGTGCTCGACTCGCTCCGCGACGGCTATAAGACGAAGACTGGTGTCCGTGTCCCGCACCCGCGCGAGTTGCTTCGCCGCAGATCAT
CGCCGTCGATCCCAGCATTCACGTCGTCGATCCAGAGCCTCAACTCTGCTATCCAGAACACCGGACGCATGTCGACGGCGAATGGCGCGAGCATGAATGG
CGGTGTTAATGGCGGCGGGTCCTTTATCCTGGCTCGCTCGTCGTCCATCTCGGGTCTGGGCGGTATCACGGGTAGTAGCGAGGGGCGAGCCACGTTCCGC
ATGAACAACCACGAACCGATCGACCGCGCGGTGCTGCTCAAGCGCAACCGAAAACGCGTCGCTCACTCAGAGAAGACGATCGTGGTCGGCGCACCAGAGG
CTGTCGTCTAAG