Description :
From Genome Similarity Track
Location :
Scaffold_624:43- 1858
Sequence
1815 bases(100 bases per row)
CGGTCTCTTGCGCTTGCCCCGCCTGCCTGTGCTCCGTCCTGACGGCGAAACCGTTCATTGTCGATGTCGAGAAGATTCGAAAGTCCAAGTTCGTCGAACG
CTTCATCCGGAAATGGCTCTGAAAAGTCCAAAGGTCGAATCATCGAAGTTGACATCGCGACTGATACCACCTGCCCCGCCTCGATGTCATAAAGTCGATA
CGCCTGGGATACTTCTTCGTAGCCCAGGAACAATCCGGGCGCGAGCCTTCGGATCCCACTTGAGCCGTTTCTCCTTCGAAATTAAGATGAAAGCTCGACA
GCCGAAGACGCGCATGTGTTTCACACTCGGCGCGGACTTGTACACAATCTCGAGCGGAGTCAAGGTCTTGCACTCGATCTTTGGTGACGGCAGGCGGTTC
TTCACGTAGATGGCCGTCATCGCCGCTTCACCCCAGAAGCACTTGTCTAGCTTGGCATGATGCAGCATGCTGCGGCCGATCGTGACGATGGTGCGGATGG
CCCGCTCTGCCGTGCCGTTAGTCTGGTGCGCGTACGGAACCGTGGTTTGTTGCTCGATGCCCTCGTCTTCGTAGAAATCCTTAAGCGAGTTAGTCGCAAA
CTCACGAGCTCCGTCGTGTCGCACGAACTTGACCTTCTTGCCAAACTGCTTCTGCACCTTCGTGATGTACGTCTTGATGCAGTCTTCGCTTTCTGATTTG
GCACGCAGGCAGAAGCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGTAGCAAATATTTGCTGCCACCAAGCGAGGACTTCTCCATGGGTCCGCAAA
TGTCGAAGTGAAGCAACTCAAAAGTGTCGTAGCGACGCTTGTCACGGCTGCTAGGGAATGGTTTTTGGACCATCTTGCCTTGCTGGCAGCCGCGACACAG
ACTTGGTCCGCTAGGCTTGGAAGGTGCTTTCGCGTCCTTGATCATCTTGTTGTCGACCATCTTGCGAAGCACCTCGACTGGAGCGTGACCCATACGCGCA
TGTAGGTCGACCGTCCTTCCAGTTGTCGCCGCATTTGCTGATCGAAGAGGCGTGCGAAGCCAGTAGAGTCCATCTACGAGATCCGCCGATGCCACCACTT
GATTCGACTCCTTGCGTGAGATGTGCATCTCGGTGCCACCGAACACCACCTAGAACTTTCCGTTCTTGTTGATCTGCGGTACTGAAAGCAGATTCTTGCT
CATGTTAGGCACATAGAGCGCGTTCTTGATCTCGATCTCGCGCTCAGCGCGTTGGGCAGGACCACTCTTTCCACGATGTCCCCACACCCTTGATAGCCGC
CTTGTTCCGTCGGCCACCGAAAGTTCGCCTTCATTGCGCTCGATGAGATTGGCGAACTTGGACTTGTCGTTACAGATGTGGTGTGTGGCACCACTGTCGA
TCGCCCACATTCCAGACACATTCTTGTTCGTCGATACTCCACATTCCAGGGAAACCGCGAACGCTACTCGATCGTAGTCGTAGTCGTCGTCGCCGTCGTT
TCGCCACTGGATGTTGTTGGCTCCGCGTCCACGGCCGTTGCCGCCGCGTCGAGCACCTCGACCCTCATCCTTCTGCTTGGTCCAGCACTTGTCAATCATG
TGCCCCAATTTCCCGCAGTACGTGCATTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTAGCCGCGTTTTCAGTCTTCACCGTCGCCGTCTTCTCACCTT
GTCGCTTGATGTGCTCGTTTGTGAGCACTTTCACAACGTCTTGCGACCGCAGCTCTGCGTTGCTCATCTCCAGATTGAGCACGACGTTCTCGTAGCTCTT
GGGGAGACTTCGCAG