Description :
From Genome Similarity Track
Location :
Scaffold_2045:43- 1768
Sequence
1725 bases(100 bases per row)
TGCAGGAGGAGTTCGTGCGAGGGTTGCGGATCGATCGGATTCGTCGAGCACAGGATGAAGAAACGTGGATCGCGGGTATGAAGAAGTATCTGAGGAGAGA
TGTGGCAGATCTGACACAGGATGAGGCCCGATCCTATGGCAACCTCGCAGCGGACTACGAGATCGACGGTGATAATCTGCTGTTCTATTGCCCACCCTCC
AAGCGATCGGATGCAGATCGAGATGGACTGATGAGACTGGTGGCACCGGAGACGCTGCATCAAGCCATCCTGCATCACTATCACCCCACTCTGGAAGGGG
GACACCAGGGGATCGGGCGTACATATCAGCCGATCCGCGATAACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCAGAAGTACGTCGGCGAATGTGTCGA
CTGCGAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCATAGCAATGGATCACATACCT
TCGCTACCCAAGTCGTACAAGGGTAATACGGAACTGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCCTCCCGAACGGTGC
AGACGATCGCCGAATCTTACGAAGAGTGCGTGTTCCGGCGATTTGGTGCTAGCGAGGTGATCAGGCACGATCGAGAGCCGGGATTTATGGCTGACTTCTT
CCGCGCCTTTAACAAGGTCCTGGGTATGCGTCAGCGAGCGACGATGGCATATCGACCTCAGGCTAACGGTACTGCAGAGCGAATGGTACAGACGGCGACG
AGGGCCCTGAAGATCTTCGTGGAGGATCTGGATCAGAGGGATTGGGATGAGTACGCAGAGCGATTGACCTTCGCGATGAACACGGCTCAGGATCGGGTCC
GTGGAGACTCCCCTTTTTATCTGGTGCATGGATGGGATCCTCGATCGACGCTCGAGGCAACGATACCTTTGGGTAGTACCCGGACTCGGGATCGGGATCC
TCGACGGTGGCGTTATCGGATCCAGAAGCACTACGATCAGGCTCGAAGTCAGGTGAATGCTCGACTACGCGAGGCGATCGCGGATCGGGCCGATCGACAC
AATGAAGAAGTTCGACCGCACTCGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCGAGTGAAAGAGGGGTATGCCCGGAAGTTGGCCCACCTGT
GGCACGGCCCGTTCCGTGTTGCGGAGAAGATGAACGAATATACGATGAAGCTTCAGATCGCTGGTACGGACTATCACCTGTTCCCGATCGTGCATGTTTC
GAAGCTGAAGCTGGTCAGGGACTTCCCCGATCGACCGCAGATCGCGCTCACGGTGGACGCAGCGGATCGACTCGATTTCGACGAAGTCTTACTTCCGGAG
GACAGCTGGGCCCCAGATCGAGACGCGAATGAGTACGAAGTAGAGGAGATCACGGATATGCGGACGGGTCGAAGGACGCGGTACGACCGGACTTATCGAG
AATTTCTGGTGCACTGGAAGGGTGACGACGAGCCTGACTGGGTCGACGAAGCTGATCTCAACTGTGGAGCTTTATTGCACGAGTTCCTTCGAGATCGCGT
GAACCGGAACCGATTCAGCGCGATGCAGTCTCGCGAGGAGGAGTGAGATCGGGTCAGCTTGGTGAGAGAGAGGGATGACGGATCGACGGGGAGGCCGTTG
ATCGGAGGAAGGGGTTGTATATGAA