Description :
From Genome Similarity Track
Location :
Scaffold_2487:43- 1605
Sequence
1562 bases(100 bases per row)
CGCGAAAGATCCTACAGAGGGATCGTCGGATTGAGGTCCAAGCGGTGGAGGTTGAATCCAAGACCGGGGGGGATCCCCAGAGCCGGCCCCTAGATAGCTC
AGGGTTGGTGGATGGAGGATCGCAGAGAGCGGAAGCCGAGTCGCCAGGTCCCGCTACCCCGGAAGTGGATCCTAGCTTTTCATGGGACAAAGTGCCTGGA
TCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCGCTAGAGGATCGACTAGATCCAACTGGTGGCTTCCCCGATACCAGGG
TACCTGATCCCACGAAGACAGAAGGACTGACAGGTGAAAGAGGGTCGCGGTGCTTGGATCCAATGGTGGATCCGACGAAGACGGAAGGTGAACAAGTATG
TTACCATGAAGGCGGGGATCTACACGCCGAGGATCTCGGGGATGGCCTAGCGGTAATCCCGGAGGTACCACTGACCACAGAGGAGGTCACAATTGACGAT
ATTCAAGTGGATCCAGGGGCAAACGAGCCCGCGAAAGTGGATCGGTTACGTCAGAAAATCTGGGTAAGCCGACATCTGCTGATTGGTAAAGGTAATGTGT
TACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCTGAGAAAA
ACTATCAGATCTGATTAAGGGTCTGCTGCAAGCCAAGATCATCTGTTTCTCGACATCCCCGTGGGCGTCTCCTGTAGTTTTTTTTATCATTATTAAGAAG
TACGAGGTGGGTATACGTCTGTGTATTGATTATCGGATGGTTAGCGGTCTGACCCGATTGATGGTGTATCCAATGCCTCTAATCAATGAGCTATTGGGAG
ATTTGGATAAAGTACTCTGGTACTGTTCTCTTGGCATGGCCAGTGGTTTCTGGGTGGTGACTATGCCGGATCAAGCTCGCGCAATATCCGCCTCCATCAC
CCCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCCTGATCGATAACGCCCTCTATGGATTCAC
CCGAATACCGGAGCCCGAAAAGGGTGGATCCGGGGAAGATCATACGGAAGTGGATGCATTCGAAGCAGGAGAGCCAGGGGATCCTGGGACCCCGTCTGTG
TTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCAGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCATGTCGGTGATCTTCTCGACTTC
GAACTCGTCGGCCTCGCGATCCACATTCCAACTATCTTCCGGTAGGAGGCCTTCGTCGAAATCCACCCGGTCGGATCCATCCACCGAAAGCCGGGTTTGC
GGCCGGTCCGGATATTCCATGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCTGTACCTGCCGTTTCCAACTTCACCGCATGCT
CCCCTATCTTTTCGCTCACCCGGAACGGTCCGTGCCATAGATGAGCCAATTTGCGGGCGTAC