Description :
From Genome Similarity Track
Location :
Scaffold_1651:43- 1249
Transcript NameFunction/comments
Phyke_g12035hypothetical protein PHYSODRAFT_525100

Sequence
1206 bases(100 bases per row)
GATACCGTGCACggccacaacagcatcaccagTCTTCAGCCAGCCAAGCTCCTTGCCGGTCTCCGTCGCACGGTACAGGATCGAGTCCGTGCCGATCATC
GAGCCCACGCAACGAGACACAACGCCCTTCACGAAGCCTTCAGTCTGACGGGCCGTCTGCTCCAGAGCGGTCAGCACGAGCACAGGCATCTGAGGACGGT
ACTTGGCAACAAGACGAGCGGTGTTGCCCGTCTCCGTCAGCACCACTAGCATCTTCGCATCGATGTCGATTGCCGTCTTCACAGCCGATGACGCAACGGC
CTCTGCTGTCTGCATCGGACCGTtcacttccagcacagcGTTGCGCAGCGACTGATACACATCATTGTAGTGAATCGCAGTCTCAGCTTGCACACACGTC
GCAGACATCACCTCCACAGCCTGCGTCGGATAGTCGCCGTTGGCGCTCTCGCCCGAAAGCATCACGGCGTCCGTGCCGTCCAACACGGCGTTGGCAACAT
CCGTGCACTCAGCACGCGTCGGACGCGGAGCGCTGATCATCGACTCCAGCATTTGCGTGGCAGTCACCACAGGCTTGCCGGCCAGGTTCGCCTTGCggat
catcatcttctgtgCAAGGAACACCGTCTCAGGTGGGATCTCCATGCCCAAGTCACCACGGGCAACCATGATGCCGTCCGTCTTCGCCAGGATCTCATCG
AAGTTCTCCATGCCCTCGTGCGACTCAATCTTCGAGATAATCTTGATGCCGCGGCCGCGGGGGCCAAGCACCTTGCGGATGTTGTCAAGGTCCTGGCCCG
TGCGCACGAACGAAGCGGCGACGTAGTCAATGCCATGCACCAGACCGAAGTTCACCAGatcgtcctcgtccttctcagTCAGCGTAGGCAGGAGCACCTT
GCAGCCAGGCAGGTTCATGTTCTTGCGCTCACCCAGAGTGGCCGTGTTGTTGGCGCGGCAAACGATGCCGTTGTCCTTGATCTCCACGACGGTAAGGACA
AGCGAGCCGTCAGCCACAAGGACCGAGCCGCCCACCTGCACGGACTCTGGCAGCTGCGGGTACGAGCACGCAATCTTGGTCTCGTCACCCAGGAACTCGT
AGTCCGTCGTCAACTCGATCAGGGAGTCCTTCTGGATCGTCACCTTGCTCTTGTTGGCAAGGAAACCCGTACGGATTTCAGGGCCCTTCGTGTCCAGCAT
GATGGC