Description :
From Genome Similarity Track
Location :
Scaffold_1684:43- 1097
Sequence
1054 bases(100 bases per row)
GCTGTACTCTCTGGAGGGCGATTCGATCGCTCTCATAGTTGCGCTGCACCGAATAGCTGGGTGCGAGCAGACGACTTCAGCCGTCATGAGACTGTGTCTT
ACGTCTTCAGGCAGAGGATTCCCTGCCAGAGATGCCCCCAACGTGCGCATCTCTTGCGCGTACTCCTGCAGCTTACGTTTACCTTGCTTACACGCGAGAA
GCGTGAGCGCTGGCAGAACTCGTTGCTCGCCGGTAGGAACGCGGATCGAAGCTGCTCACACAGCTGAGCCCAGGATGCAAAGCATCCAGGAGATATCGTC
TCCCTGGTGTATGCCCAGTGCTTGGCACGGCCACCAAGGTTGGCCAGGGCAAACGCCACCCGAACTGGCTCGTCCGAGATGAGACCCGCCTTCATTGCGA
TCTTCACCTCACGGACCCAGAAGTGAAGGCTCTCTCCTTCCTTCCCCTCAAACAAACGGCCATCGTGGCCTTCAAGCTCCCGCGAACGTGAGCGATGAGA
CCACGCTCGTAGGTCTCAAACGCGGTCACTCGCTCTTGTTGCTCGGCAGGCGTCACCGCCGCCAAGCTGCGAAGGACATCTTGTCCAAAGATGCCTCCCA
TCTTCAGAACAGACTCGTACTGTGAGTCGTTCAAGCGAGGAAACTCGCTTCGGTCCATCTTGGCTCAAACGTTGGGCGCACAGAGGATTCAGGTAGCTCA
ATCTACCCGCGATGGTGTTGGATTGACGATGAGTGCTACTAAGTGTGACGGGGTCACACAGCACCTTGCACAGAGGAAGTGCTTAAGGGTATTAATTACC
CGAGTGAACGTAAGTCCACGTGTTCCCGGCCTCAGTGGGAACGATTTGCTACTTAGAGGAGTAGATTTAAGACTGATGTATTTATAAGTAAGATAAGCTT
GGGTCTCATACAAACTAGAGGTTACCTATAGTGGAGCTAAGTAGTCATGCACTGACTGGCTCCGAGAGCACCTGGTACCGTGTACCAGGTGTCCACAAGA
GTGACGGGTCACTCTTTATGTAACATGGGGCACACTGGATTGTACCCCGTTACA