Description :
From Genome Similarity Track
Location :
Scaffold_9:429866- 430907
Transcript NameFunction/comments
Physo_306694Hypothetical protein

Sequence
1041 bases(100 bases per row)
CTATTGAGCTGGCGACACGAGCTAAGCACGTCTGCTGCTCTCTCTTGCACCGTTGTCTTGAACAATTTGCTAAAAGCCGCTTCAATTTTTCGGATTTCAC
TGTGTAATAGCGTCAAGGAGTTAGATGCGACAACAGATTAAAATGAAGGGTAAACCGACGATTAGCTGCGAGAGCCCTTACCGTGACAGCTCCACTCTGC
GTCTAAGGTTCGATAACTTGTCGGCGTAAGATTTCGAAACCGCAGTGAGACTGTCATACAGCTCGAGAAGCTCTGAGTCGCGAGGATCATCTCGAGCCCA
CTTCACGATCGACCTGAACACTCCGATTATCTCGATCGGCTGCTTCAGAGAAACAACGGGTGCTGACATGGCTTCGCTCAGTGCATTGAAAGCCTGGGCG
ACGTGCTTCCTTCTTTCCGTGGGTACCATAGCAGTTACGTGCCACACGTAAAGGTCATAACTGAGGAGCACGTAACTCTTTGCTTCATCGCTCACTTGCA
GCATTTGGTGCTCAACAACGTTGGACAACGTTTCGCCAAGTCTGAAAACAGTAGAATCATACCAGTATCGGCAAGTGCGAATGGGTTAGAAAAGTGCTAT
CCCATCCTACATCAAATAACACCGCTTACCTCCTTAGACCGCGCACGTCGGTGCTCTCCTCAAGCTGGTTAATCCACTCCAATACAGCACCACAAAAGTT
GCGGAGCGCTTGTAGGGCGCGCTCCTGTCCGGAGATCAGATGAGCCCACAATACCACGTATTTCATGACAATGATGGCATTTGACAAGCCAATCTCGGGC
ATCACTTTCACCAATGCGGGCAGTACAGCAGGCAGGCAACTGCTCCGCACCAGCACGGGTAGTCGGGCCACCTTCAGCACCTCATCTATGCAGTTTTCCG
TGTTCAAAGCGGATGTCCAAGATGCATTCGTAGTATCGTTCGAGTCACTGCCGGCCTCGTCATCCAGTTGGAGAAAAACCTTCACAGTTGGTTTGGGGGG
CAGCTGTATCGATGCTGCATTCTCCCCGCCGTCATTTGAGC