Description :
From Genome Similarity Track
Location :
Scaffold_809:4298- 6528
Transcript NameFunction/comments
Phymu_g12033Phosphatidylinositol 4-phosphate 5-kinase (PIPK-D12/GPCR-PIPK)

Sequence
2230 bases(100 bases per row)
AAGGCCATAATGGTGTacgaggcgctggcgttggcgcagAGTGCGCAGTTGTACTTGCTGGTGGGGGTGCTGGGGGTCGTGCTGTACCTTCTCTTGGTCA
TGtccttcttcctcgtgcCCAACATCAAGGCGCAGCACCCAGCGGCGGACCTCGTCGTGTGGCACGCAGGCTGCGGCCTCATGACGTCCGTGGGCTTCGT
CTTGGGCTTTGTATTGCAGCGGCAGGACGTGGAGCCgcaggacgaagagctgaTCCACTGGCAGTGCTCTCTACTGGGCCCTTtcaaccagttcttcctc
ctgGCAGGCGCCTGCTGGTACCTCATGCTCACTCTGGACCTGCTCGTGGCTCTGGTAAACCCGTGGATGGGCTACAGCTGCAAGTCCTGGGCCTACCACA
CCATGTACGACGTGAATCTTTGGTTATATTTCTCATCTTGCAGAACTACTAGTTACTGACGCTTTGTCTTGCTCTACCTGCTGCCAGTGTGTGGAGTGTC
AGTGCGGTgtctgctctgctgctgcatcagctgAACCTCTTCGGCCTCTCCTCGCTCAATATCTGCTGGGTCAAGCGCACCAAGGACCCGACAGAGATCA
ACAGAACCAACtgggtcttcttcttcgccattgTGGGCGCCACTTGCGTCGTATCACtcgcagtgctgctgttcgcgAGCTTCCGCTTTGTGAGGAGACA
GCTGGACGTCACGTATCGAGCCAAGCGCCGCAATTTGATGCAGTACTACCGCTATCTACTGGTCTTTGCGGGCCATTGGGTGGCCTGTGGGGCGCTCTAC
TATGCGGCCTacctccagcagttcgacgGCAAATTGGCAAAGCACTTTGAACTCGCCTTCGCTCTCGTGTTTGGCTCGTAcccggcgctgctgctcattg
TGTGGGTGCTCAATACGGAGCTGTACCAGAATTTCTCGAGCGAAAACAATCTATCGAAGTCGGAGCGGGGAACAGGAGGGATGACGAGTACGGAGCACTT
CAGTGCGGCACTACGGAAGGATTTGATGCGCTACACGACTGCAGGGatccgctgcagcatctgcgaGTCTCCTGCCGACAGCTTACGATCGCCACTACTG
AGTCTCGCTCGGGATCGTTTCGGGTCTCTTGATCGAAGTGCGGCGTTGTCATTTTTGCAAATGGAAGAGGGCGACTCGGCTGGCCTTTAtcacgagaaga
agaggttaGCGACCACGGTGTACAACGGCGAGTATCGGTACTACGAAAAGCTGGGCTTCACTGACTACGCACCCAAAGTGTTCCAGAACATCCGAGAGAT
TTGCGGTATCGACAATGAAATGTATGAGCAGTCGTTCGCAGATACGCTACTGGAGCGCGCTTCCGAGGGCAAGTCTGGGATGCTGTTCTACTTCACTAGC
GACCGCAAGTACTTGGTGAAGAccatgacgaagaaggagcattcgttcctgctggagGTGCTCCCACTGTTCCACCAGTACATTCTAAAGCAGCCAAACT
CGCTCTTGTGTCGCTTCCTGGGCTGTCACTCGATGCAGCTTCCCGTTGGATGGAACAAAATGTTCTTCGTCGTGATGGAAAACATCTTCCCGGATGGCCC
AGTCGACGAGCGCTATGACCTCAAGGGAATCTTTCACCAGTCCAACTTTCGATACCAAGAAGGTATTCCGACACCAGTGTCAAGCGAGTGGAGTCGCAGT
GGcagggaagaagaagggggCGCTCATAatgcggaagaagaggaagcagcatCAAGCGAAAGCCACAGTGTGGATAGTGAGCTGATGCAGGTTACAGAGA
AGCAgccactgctgcgtcgtggGAGCTCTCGCCCTTCGCTCCGATACGACAACGACTTTGTACTTCGTCGAGCCTCCCTTCGTGTAAATCCAACGACTCG
TGCAAACCTGCTCGCTCAGGTAACAAGTGATTGCGGTTTTCTCCAGGAGCTTGGAATTATGGACTACAGTTGCCTGCTCGGAATCCGGCATTACAACCAG
CGTATTGAACCCGACATTTTGGACAGTTTGGCGCATAATGCTGTCGTTTCAGCAGACCAGTCGACCGTCTACTATCTCGGCTTTGTAGACATTTTGCAGC
ACTACAACATCGGGTGGAAAATGCAGCACTGTTTGCTGGCCGCAGTAGTGGACAAGCGACAAATCACTGCGCTCCCCCCTGCTGAGTACGCTCTACGATT
TTTGAACTTCATCCACGAGTATCTGCTACG