Description :
From Genome Similarity Track
Location :
Scaffold_41:42962- 44400
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012362Similar to RRN3: RNA polymerase I-specific transcription initiation factor RRN3 (Pongo abelii)

Sequence
1438 bases(100 bases per row)
GGCGATGGATCAAACGTGCTCCGTGAGACCTTTTTGCCTGATTTCTTCTTGCTGCCGCTCGCCATGGCCTTCAAGGCGCGGTCTCGGTCGTCAAAGCTGT
AGTCGCCGTCGTTCGAGGACCCAACCGACATGCCGTACGCGCGCTGCTCGACGCTGCCGTGTATGTGGTTCTCCAGGTAGCTCAGGCCTTTGAAGGACGC
GACGCCGACGCTACCCGACATGCTCACATCGTCGTCCCGGTCAACGTCTTCTTCGTCGTCATCGTCCTCGTCAGCCTCCTCCTCGTCGTCGTCCTCGACC
TCAGCTTCAAACTCGCGGATGATCGCCTTGACTGCGTTCAGCGCGTCGCAGTTCTCGCTCGAAGTCGGATCGGCGTGCTTCCAATATAAATACAACGGGC
CAATGTACTTGAACGATCGACGCAGCAAGTACGGGTCGAACGGGAAAAACGTCTCGAGCGGCTGGCGCTGGCCGAGAAGGGTCGACGGCGCACTGGCGTT
CGAGCTCGGCGCCTTCGACCGCTCCATCGTCTTGGTCTTGGTCTTGAACGCGCCTTTGCCCGAGCTGCTGATCGCCTGATCCACACGGTCGATGCACTCC
TCCGAGATCAGATCAAAGGTCTCGACAAAGTTGAGGAACTCGGTCGCGACAGTCTGCTGGCAAAATGCCAACGGACAGTACGATGTCGACGTGATCAGCA
GCCGCTCCCAGCCGAGCGTGCGCAGAAAATCGTACCCGTTTGGCGTCTGCGCGATCTCGAGGCCGCGGAAACACAGCATGTAGCACACGGTCTGCAGCGT
CGAGATGAAGATCGACTCTTGGAAATTGCCGCGCGTGTCCTTGGCTTCGAGCTCAGCTGCCTCAGCTTCGATATTCCCTTGGGCGTCTGGATCTTTCGGC
TGCAATGCGGCATCGTAAACGTCCATTTGGTCATGCATCCATTTCAGCAAATGGTACAACGCCTTCTGGATATACGCGACCGAGATGTACTTTGCACGCG
CCAAGAAACTCGCCAAGTACGCGCCACAGCTGTGTCGCGTGACAGGCGGCACCTGAGGATCCAACGACGCAGCCAGAAGTTGCGAAATCAGCACGTCCTG
GAACTGCGGATCCATGCGGCAGATATAAAACAGGAGAAACTGCGGGTACTTGGATCGATGCGTGTTGAGAATTGAATGCTCAAACACCTTGAGCAAGTAC
TTGAACACCAGCGCGGCTTTCTGAACATTTAATACAGTCGTAGCATCTGCATTGGTGCTTTCACTACCACTTGCTGGAGCGCCCACGATCTCTTCAATGT
GCGAAAACATGATCACCATCATCTGGTCGAGTTTGTCGGCCATCTCGTCCAGTTTTGAACTGTCAGGCGGCAACAACTCGTCGTCCAAGAAATCGTCCAT
CGTAAAAATGTCTTCTTCTTTCTCGTCCAGTTTGATTT