Description :
From Genome Similarity Track
Location :
Scaffold_921:4296- 10387
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_921-fgenesh-gene-0.060S ribosomal protein L13
Pytap_DAOMBR444maker-pag1_scaffold_921-fgenesh-gene-0.3Folate-Biopterin Transporter (FBT) family
Pytap_DAOMBR444maker-pag1_scaffold_921-fgenesh-gene-0.1CDS Pa_4_9260
Pytap_DAOMBR444maker-pag1_scaffold_921-snap-gene-0.9Conserved gene of unknown function

Sequence
6091 bases(100 bases per row)
TGATTGGCTCCGGTCAGGACAGTATAGTGAAAGCCAGTGAGTGTGAGGACTGGTTCTCACTGGCgTTGGGGAACCACCAATTCGTTGGGAGCTGCTGCCC
ACGGGGTGTGTTCCCACCAGCGACCAATAATCTGCTCCAAGTTCCAAATTGGCACAACTTTCTGACGAAGGTATGGCGGCGTGGCGCGTGATGATGCGCT
CCCAGAGGCGGCCGACGCTCGGTCTGTAGCGCGGAGATGGCGCAGGGACGAGCGGAGGACGCGAATGGGGGAGGCATCGAAAGCAGCAGACAGCGAGGAC
TGATGTGGCGCGATGGCTTGCAGTTGAAAAATGGTGAAGCACAACAACGTCATCCCTAATGGCCACTTCCACAAGGACTGGCAGCGTCGCATCAAGACGT
GGTTCGACCAGGTAAGCGGATTGTCGAGATGAGAGTGGGTCTCGGGGTAACGAACGGAGCGACGGAGACGGGATCGGGATCGGGACTCGAAACGGACGCG
TCCGACATGATAGCGACACGATGACGAGTAAAAGCGACTGGCAGATGGCGTAGCAGTTCACAGAATCGATCGCTACAGGTGTCGGCCATTGCCTCGGTCG
AGTTCGGCAGCGAAACGTTGTGTATCTTGCCAGCTTTACGAAACGACGCATCTTCACATCGTCGTCAGCGACTGTATGCAGTACTCGACCATGCCGCCTC
GGAGTGTTCGCGTTTTCATTCCCAGAGACCCACCAACGGTGTTGATAATGAGTTCTCACATACGTCTGCGACAATCCATAACAGGCCGCCAAGAAGAAGT
CGCGCCGCTTGAGACGTAAGGAGAAGGCTGCCGCCGTCGCCCCACGCCCAGCTGCTGGTCTTCTGCGCCCTGCCGTGCACTGCCAGACCATCAAGTACGC
CTCGAAGGTGCGCGCCGGTAAGGGTTTCACCCTCGAGGAGCTGAAGGAGGCTGGCATCAGCAAGAAGCAGGCCCTCTCGATCGGCATTGCTGTTGACTAC
CGCCGCACCAACAAGTCGGTGGAGTCGCTCCAGGCCAACGTCCAGCGCCTCAAGGCCTACAAGGCTAAGCTCGTGATCTTCCCACGCAAGAGCCTCAACA
AGCCAAAGCACGGTGACTCGTCTCCTGAGGAGACCAAGAACGCCGTCCAGGTTGCTGGTGCCCTCTTCCCAATCACCCGCACTGTGCTCAAGTCGGAGTC
GGGCGTGATCACGGAGGAGATGAAGGAGGAGAGCGTGTACGCTAAGCTCCGTGTTGCTCGTGCCGATGCCCGCATCGCCGGCAAGCAGAAGAAGCGCCTT
GCCGACAAGGCCGCCGCCAAGGAATAAGCGTGTGGACCTGCAGCCGAAGCGAGTTGTCATTAGGAACTTCTAACACACCAATGCTCAATGTGGAACGACG
ATTGGGTCACCAAATGCAGCGTTCGTTGTGCCTCTCTTACGTCGTCTTCGTTAGATCTCACTTTTGTTCAGATGGATGTGCGCTGATTTGCTTTATCATT
CAAGGTTGACCCTTTAGTATTGGACATCAGTAGTTCGGTCCTATTCTATGCGTGGCTTCCTGGCAAGAGCGGCTCGAGCTCCGCAGACTTTTGAGATGCC
TTGGTCTGTACATGGGCTTTTTGAGGGAGCACATACAGGAAAGCGAGCACAAGGAGCTGACACCCCGACGAGATCAGCACGAGAATCCAGAGGTTGTCCC
AGTTGACAAGCTGAGTCACGGGGTCTGGAACGATGCCCAGGAGTGTGACCACAAGTGAGCTGAAGATCCCAGATAACACGCCACCAAAGTCCATGAACGA
CAAATACAAAGCATACGTGAGTCCGTGCACTTCGCGGTTGTCAGGACAATAGTACGTGGCCACAACAAGCAGCTGAAGGAGGGCAAATTCGGCCGTGAAC
GATGCGATGAATGACTCGATGACACCAAAAGAGCAGATTGAGATCGTCAAATTCGCGACTGGTGGTGTGAGGAACAGCCGAGGAAGACCAGCGACCACAG
AGCTCACTGTGGATGCCAAAAAGACGTGACGCACGTTGCGGCCACTGCAAACCTTCGCGTACATGATGCACGACAGGAATCTCCCCACCATGCCTGCTAG
GGACGAGTATTGCAAACACTCGGGTTGATCGCCCAGCAGTGAAAAAGTGTACTGGTACCACACAGTGCCGTCGCTGGGGAGGGCACTGCACAGCAAAAAG
AaGAGCATCGTTGGCAACACGGGCTTCATGATTTTGAACTTGGCCTTCGTGTCAGCCTTGAACGACTTCCAACCATCTTTAATCGCTGCGACGAATGCCC
AACAGCCTGTCTTGGGGCGCAAGTACTCAGCCGCGTTTGGCTCGCCCGCAGGCTCCTTCGTACCGTACGCTTTACGCGCTTCGTTGATGCCTACTGCACA
CACGATAGCGCTGATCAGAGGGAACACGGCCGTGAAGGAGATGACGCTTTGAGGAGTGATCGACTTGTCCTTGTAGATCGGGATGCCGATCACGAGCGCG
AGAATGGACGCCAaGTTCTTGGCGCCATTCGACCACGACTGCACCACCGCCGAGCTCCTGCTCGTCGCGTCTCCTGCCGCCAGGTCAACGaGGAAGaTAC
CGAGCATGATCTGGGAGAAGGCTTCAAACACAGCATCGACTACCTTGACGATGAACGCGCCGGTGAtGGTTGAGATGTACGCGCCCGTGACGAAGAGCGA
GAGCGCGGCGCCGATCTCACACAGCATGATGTAGGACTTGCGATGGTAGCCAGCGATCGGGAAGTTGTCTGAGATGAGGCCGTAGAGAGGTTTGAGGTTC
CACGGGAAGAACGAGACCGAGTAATAGATGGTCGTGGTCGCCGGCGGCATGTGGATGACCTGGAAGAGCCACTCGCCGTACGCTGTCATGGGGAACGTCA
TGAAGAACGAGTGCAGGAAGTAAAGCGCTAGCAGCCCATACGGCACGCGCGCGAGGGCCGTCATGAGGGCGGCGAGCCGGCAAGTGGGGGgAgAGAGAGA
TCGCCGTGTgCCACCGCCAAGTTCAATGCCGCCATGGTGACGCCATGTAGCCACCTACGACCGAACAGTATATTCTGTTGGCAACGGTACGCCACGTACG
TTCCTACTAGCCTATCGATTGGTTGATATCTACTCCCGACTTCATTTTGATTCGCTGAAAAGAAAaTGATTCCATATGCCGTCTTGATTGGATAATATTC
GTGCCCATCGAGACGGACGGAACTGCTGGACGCTGGAAACGGTGTCGCCATCATCCAGGAAGCGAGTGTGAGACGCAGGCAGCCATGGCGACGCGCAAGC
ACTTTGACGTGGACGACGCAGAGGACTATGACGACGGCACGCGCGCTGTGACATACGACGATGAGGCGGAGCGAGAGCTGCTGCAATCGGACTCAGATGA
GGAGCAGGTCAAGTTGAGCTCGTCGCGCAAACAGCGTCTCCAAGCCGGGAGTAAGAAGACCAAGCAGAATAGAGAACGCGCGTCAGCGCTGCGCGTGAAG
AACTGGGATGCGGGCCTCATGGACAGCGCCGAGTATGCGGGCAAGGTCGTGAAGCGCAAGGATGTGACGGAAGAAGAAAGCGAGGACGAAGGCATGGCGT
CGCCGGACGAAGATGCGATGGAGCAGTGGTCGGATGCTGAGCCGTTTGGTGCCTCGGATGATGAAGAAGATGCAGAGGAAGAAGAAGAATTGCCGGTGGA
TGAGTCGGGAAGCGACGACGAAGACGAGGACGAGGCGGATGCGGAGAAGCTGATCCGCGGGTTTGAGAAAGAAGACTCGGCACAGCTCATGAACTCCAAG
GACAGCGCAAAGCTTGTGGAAAAGGCCACTCATGTGCGCAACCAGAAGATCATTTGGGAGCGCTGTCTGGAGATCCAGATCTACACGAAGCGACTGCTAA
CGTCAACCAAGGCCGCGGCTGACAGCAACGAAGATGTCGATGAAGACAAGAAGAAGGAGCTCCTGGAGCAGCTCTACTCATGCATTGACACCGTGTCAGA
CCTGCAGGAGAAGCTCTGCAACTCGGACGAGCTCTCCATTGAAGATCGCGAGAGCAAGAAGCGCAAGCGAACGGTCGAGGATGTGTGGGAGCAAATCGTC
AGCACGAACCAAGAAGTGCTACCTCAGTACAACGACATTCTCAACACTTCGACTCGCAAGACTGATCTGGCGGGTGGAAATCAGGCCAAGAAGTTCAAGG
CCGTGAACCAAGACATCCTGGCGCAAGTCGAGTCGGTGCTCGCGGATCCGCAGCGCGTGAAGCGGAAAGCCCATGCTCCGGTTGACCCCGTTGACGAGAA
CGGACACACGACGGAAGAAGACGACGGCGAGGCATTGGACCAGCTGGATGAACTCATGTACGACGACTTTGACTTCTACCAGCAGTTACTCAAGGAGTTC
ATTGAGAGCGGCGGAGGCGGTCAGGACGGACTCATTCGTCGCACACACCGCAAGATGAAGAAGATGGTGAACCGAAAGGCGAGTAAGGGGCGTGTGCTGC
GGTACACTGTGCACCCCAAGCTCGAGAACTTCATGTTCCCGGAGCCTTACCCAGCACCTGAGTTGGATGTGGACGAGCTGTTCCGCTCCATCTTCGGCCA
GGCACGCCAGGCTTAAGTTATATCTTAACACATCATAGAGACCTCACTTACGATTAATCTGCTAGGGTGAACCTCTTTTCTCTACAGCACGTCGTCTTCA
TCTTCTTCTTCTTGCTGCCCACTGAGATACTCCTCTCGGAGTTCTTTCGCCTTTGCTTCTACCGCCGCTAGTCGTGCATCGTTCACTCCGTGGGCACCAA
GCTTCTTGACGATACCGACGAGTTGAGCAGCCTTCTCTGCCACGTGAATCACCGTGTGAGCACGAATCTTCTTTGCTCTTGTCGTCGTGTCCAGAATGCG
GAACTCTTCTTCTGCGAGATCCATGGCTGCGTCCGCCAGCACAGTCGATGCATCGATGAGTTCTGCTCCTCGATCATCGAACCGCtCTGGAATATGATTC
TCATGCAGTCGCCGTAACTCTGCAGCGTACAAAGCGTTCTTGAACACCTTGTGCTTGAGCTTCACCGTGTCCTTGAGCAGTTGCGTGAATTTGTCAATCA
GCTCCGCCTTGTTCTTCACTGCTGCTCGCAGTGTGAACGGTGCGTTCAGAACTTGTGCTCGCTTTGAGATGAGTTGTCCCGCATCACGCTCCAAGAACGA
CATGCTCCAAAGTCGACCATACGCTTTCCCAGCGTCCAACCGCTCTTCTTCACTGAAGTACCAGTCCCTGGTGTCCTTGTTCTTGATCAACAATCGTGCC
GACCACGTTTGCACCGCATCCGTACCCAACGACAAACCAAATGCTTCGAGCTTTGGGGAAACTTCGTTGTAGAATCGGATCGCGTGTTCATCACTCAAGA
GTTTCtCATTCAGCACTTGGtGGATGAGCTGCACGATCTCATCTCGGTGCTCCACCAGCTTCTTGTTGCTTTCCTTGCGCGCCTTTTTCTCCAACTGCTC
GATCATGCTCATACCCCCcATGCCCTTCGTCTGCGGCTGTTCACCACCGAAGATATCATCTAACGCACTCTCGGCTGCAGCCAGTTCTTTTGCCATTTGG
TCTTCGACAGTCGgTGGGGGgCCACCGCCCAGTCCACCTCCGGGTGCCACGCGTCCGTTTCCGCCATTTCCaCCACCAATTGTAGCATTtCCTGACGACA
CTGTTCCGCCAAGCAGTTAGAACACGGGATGGCTCCAAAGCATGGACGGAGCGGCTCACCTTGCTGAATGACCTGTTGGTGCTGCATCAGGATACTGAAA
AGTTGTTCcATTGAAATCGGACCTGATGGAGGAGCTCCACTCGGTGATGGTGGGGGCTGTAAGAGTCCAACATAACGAGTGAGCCCTCTTACGTCCTGTG
AAAAACGAATCAAAGAACGACGTACCCCTGGATCGTTCGGAGAAACATCATCTGGTCGGTCTAGCATTGTTGGGTCGATGCCTTCCGCGGACATTTtGAG
CTTGATCTGCTCagcaggcATGCCCATTTGCTGAAGTTTGAAGAACTTCTTGAATTggctcatcttccttgacaagcaaaggcttgtacgg