Description :
From Genome Similarity Track
Location :
contig_17:429579- 439279
Transcript NameFunction/comments
g4080.t1hypothetical protein AM587_10010695
g4081.t1hypothetical protein PHYSODRAFT_472012
g4082.t1cell division protease ftsH
g4083.t1hypothetical protein PHYSODRAFT_304926

Sequence
9700 bases(100 bases per row)
TCGAGCTGCTCTGGGAAGAAGGACGGGTGCTTCAATGGGCCTCAAGTATTCTGCTTGCTTCATGTACTTTGGGGAGGACGAGGACGAAACAAAGTACCCC
CAGGAGAGGAGGACGAGGACGTTGTTCATGTGTAGGATGTGGTTTAACGTGCACGCCATTGTTCAGCAGATGCCCATGAGCGAAGTCAACAAAGGCATTG
CTATGATGCGTGAGGGCCGTGGTGCGCTACCACATCGTGCTGCGCGACGTCAAGCCCGTGTACAAGAAGAAGTTTGGCAAGGATCTGCGCGAGCTGCTGC
TGTCCGTGTTCGACTAGGCTGTGCTGTTGCTGGCACTGTGGTGGTAGTGGTGCGTCGCCGCCGCGCGCTTAAGAGGGTGGAGTGCATCGTAAGCATCTGT
GAAATGTGCCAACGTGAACGTGTTTGAACAAAAGCAACATCCTTGTTGTTCATCTTGGGGCTTCTGAAACGGATGACGTTCGCACACCGAAGCGCCTTTC
ACCGCGCCAGAAGTGCCCGCATCAACTCTTCTGCGCCTCTGTGAGTTTGGTGGGGAACTGCACGTCGAACTCCACCACGAGGTTACCTCGTTGCGAGGGT
CTCTTCTGCAGCGGCATGTCCTCACTGAGGACATGCCGCTGCAAGAGACCTCCTCACCCGCGATCAGGTGAGATCGTCACGGTGTCACTGCGTCCAAGCC
TCTCGGATTTGCTTTCGAATTGCGAGGAAACCCCAAGCCGACCCGCGACTGCTTTACCACGTCTCCAAGGACACAAGCGCCGCATTTCACGAAAAGAGCA
GATGCACGACCTCCGCAATACTGTGTCGGAGCTATGAACGAAGCTGGAAGGTCTGCGGGCAGAGTCTTGGATGTGTTCGCCCATGGCATCTCCTGTATCT
TGCGCCGCAAGTCAGCATGCGACCGCTCGCCAGCTCATACTGCGTTGCAAAGCAGAAGAAGAGAACGCCAAATTGCAGGAATTACTGGCATCGCAGAGAC
GCACGGCCCGCAACATCAGACGCTTGCTCCGACGGGAGCCGGTGACGAGGTAAACGTTGTTGCGCTGGTTTTTGCTAGTTTTGATGGCTAACAGATTCAT
TTGCTGAAACTCGTTATTTTGCGTCTGTAGCTGCTAGAAGTGATACACAACTCGAAGCGCTTGAAGTTTGACAACAACGAGCAGGTTTTCCATGAGCTCC
TACACGGAATTGATACGATTTACGTGGATTTTGGCAAGCTGTACGAAGTAAAATGGATGCCAGCAGTTCCATGCCCTGGGCGGAAGCGCCGAACGGACCC
CAATGCCGCCGGCGGTGATGTTTTCGTTGAGTTTGTCGACAAGAACCAAGTCCCCTTCGATTTTCAGAGAAGTGAGCGCGCAGTGTGGAAATTTCTGCAG
GGCCCGCGGGTTCATGACGGAGGTCGTGCCTAGTAGATGTAGCTTCAGAGGCTGCTCGTTTTTGCCCTTCACTCACACTGTTGTTTGTTTGCTTTGTGGG
ATCAGGAATTTCAGCAAACTACCGAAACAAGCAAGAGTTGTGTGAGGCCATTCTCGATTTTACTGGCTTCGGCTCAAGTCTCCCAACAACTTCCAACATG
GTCCGCACCCTGTCGGTTCTAGTGTCTAGCGCAATTGCCCAGGCAGGCATTACCTCGACGTCCTCGAAGCTCCCGGTCATTTTCTTCCACGGTGTTACCA
CAACGTGGCAGTTTGGCCACAACTTTGCTGCAAATCTCACTGCTGAAGGACGTGAGGTCGTGTCACTCTCATTCTGGGACGCCCAGTGCTCCATTGAGTC
GCTCCTGATCCAAATCCCTGAGGCCGTGAAGGCCGTCCGCAACACGGTTGCCAACAACTCGGTATTTGACGATGGATACATGATCATCGGACACTCGCAA
AGAGGGATTATCACCCGTGCCACAATCGAAGAAATGGACGACCACAAAGCCAAACGCTTCATCAGTCTCGATGGTCTCCAAAACGGACAGTTCATCGGAC
ACAACGCGGTCGATATCGCCATCGAAAAGGGTGCGCCATCCCTCACTAACATCGTCCCGGAACGCGTGTTCAACTATACCAAGTATGTGCCGAAGGACTA
CTACGGCAAGATGCAGAAGGACTTCACCATCTTCTCCATCGAAAACCCGGACACTCAGTACGAGTACGCCCAATTCAACGTCCAGCGCTGGCCCCAGTTC
GGAAGCTGGTCCATCACGAACAAGCTCCTGCCTGTGTACAACAACGTGAACCCGTGTCCCCCTGGCAACGACCAGTGCATCAGTGACCAGCAGCGTCGCC
GAGCCAACTTCCTCAAACTCGAAGAAGCCCACTTCTTCGCGTCACCCGTCGACGACGCTATCATGCCGTGGGAGAGCTGCCTCTTCGGGCGCTACAGCGA
GGTGGACACGCTCGACGAAATCGAGACCAGCTTCATGAACTTGATCATTGTCAACATAACAGACACGCACGAGTACAGGGAGGACACGTTCGGAATGCGC
ACACTGGATGAGCGCGGTGGCCTGCACCTCCATATCGCTCCCATCGTGACGCACAGTTGCTGGTGCGTCGACGAGAAATACTGCAAGTGGGCTCCCGTGT
ACGACGAGTACATCTACCCGGCTTTGAATTGAGCTTCGACTTTTGAAGGGGGCGGGCAGATAAAGTAAACGATGTTAGTGAGGACTCACGTTGGACCACA
CAAAAGCTGAAGGCCGACCCGGATTGAAGCCTGGCGACACTACAACGAACGTGGCAACAAAACACACTGAGTGTCTTGGATGCCACTTCATTATTGACAG
CGGGATTCCCCGGCGAAATATGATGCCTCATACTGCTCGGAAATGTCACTCTTGGACAAACGTTTCCTGCGGAGGCACTAGGGCATTCTTGATGGAGTAA
CAACCGTGCCTCCACCACAGCCAATCACTACTGCCGCTGTGCCATCGGCTCCCGCACAAGCTTCCTCTGGAACGGCCATCCCACAATCCCTCAGTCCCTT
GAGCCAAGAAGACTTTGAGTTGGTGCTAGCGCGCATGTGGGTCATTTATGCCTTGCCGTCCATTCTGATTGAAGCACCAATTGTGCGCCTGTTGTTCTCC
CGGTTGGCTACCCATTTAAGACTGCCGTTCAGGTCCTGCTGATATCAGTTTGTGACGAAATCCAAGCCACAGTCATCGCGATTATCAGGAAAACAGGCGT
AGTGAAACTCGTGACTGATGCTTATACTGACGCCAATAAGTCGAACATCATCCATTTTATGGTGACTGGTCCAGGCATGAAATCATTCTACTGGTCGTCG
CTGCATACGGGGACGGCGCAGCACACAGCGGAATACTTGGCGATAGAACTGGAACGGGTGATTAATGATATTCAGACGAAGACGGGAGCAATGGTGACAA
CAGTGCTGACCGATAATGCCAGCAATATGTCTGGCGCTTGGGCAATTTTGGAGAGGAGGCTACCTGTGTTTGGTGGTGGTTGTCTGCTCACGGTCTCAAC
CTCGTGTTGGAGGAGGTGTTCTCGAAGATCCCCTTCGTTACTGACCTGAAAAGTACAAATTTGCCCGATTGGTTCGAGACCATCATGGGCTTCTGGAGTA
GTTCAGAAATTTGCAAGAGTCCATGGTGGAGAGGCTTCAAAAGGAAGGCACCGTGCCTCAGCAATTCCTGACCCACCCGATGGTATTCCCAGCACTCCTG
TCTTAAGAGCGTATTGACAAACCTCGAGCCTTCCTCTTGGACCCAAACACTGACACGTCGCAGTTCGTTGATTCGGATGAGGCGGCGGGCACTGTTGGAG
CAATGAAGATAAGGCGGAGTGTGCAGGGGCGAGACCACAGAGCTGGTGAAAAGTCAATGCGAACAAGAACGAGATGTATCGAGCGATCTCGCACCTTGCG
GATATTGTGTTCTCTATTTCGACTTCATCGGCAGCAAGTGAAAGGGCTTGGAGTATTATGGACTTGGTGGTATGCTTTCCGACAACAAGATTGATCTCGC
GCATCCCGAGTCGGGAGTGGAGGATACCAAAGTGATCCAACACCAAGACTTGATGTCGATTTGAGAACAGTGTCTCCGTTAAACCTCGTAGCTAGCGAGA
CATCCATAAGTTTATGAATTCATGACGTATGCATGCTTTTTCCTATTGTTCATTCTCTCATTGCGTCGCGCGTTCTGGGTTATGTTGGTTGTGCGGCCAA
ATTAATAGGAACAAGTTCGGAAACGATCCGAGCAAACCTTCGGAAAGTGTTCGCAACCAGCACTATTCTCAGTTGGGCAAATCGAGCTACGCTCCCACGT
CTACGGTCCAGAATGTTTTACCGCGTGCGAGATCTAGCAAGAAGTGCTCTCGATGTGGTTTGACAACGAATTGCTCGTCCTCACTTCCAATGGAAACTAC
ATGGCTTCGTTTATCACATGGATTATCCAAGAACGTCGGCCGACGTTCTAGCTTCCTGCTTATTATTATTAGAGAGTAGACGACCGCGGCCAAACCGGGA
GAAGGGTGGTTGGTTATTGTTTCCACGGCACAACCGCAGCCTTCAGATTGTCGACCACACGGTGTCCATGCTGGCTAAGCAGCCGTCACGGCTGGGCCCG
CACCACTCGATGGAAACCATGGAGACCGCAGGCAAGTTCGAGCCCTTTCGGTTGATCCATCGCCTGCTGGTGTTCGCTATCGCGCTGTGGTACGTGGCCA
TCTCGGCGCAGGCCTTCGTGGCTGCAGTCACAGTGCTGCGAGGCCTCGAGTCGAAGGATCTAGGTGTAACCGTGTACACGTCCAAGCTCATTGCAGGTTA
TGCTGGCGAGACCACTATCCACGACAGTCCATTGGTGCAGAACGTGTTGGGAGGGTCAACCGAACCCCGGGACGACGCGATTTATCTCGAGACGGATACC
TCCGTCTCGTTCACAGGATGCTCAACTTTTGAAGGTGCAGACAGCAGCGTCTACAGCAACGGCTTTACTCGGCTGCTGTTCACCTCTTTGCAGAAGCACG
CGAGGGGAAATCTCTCGTACGTCGAGGAGCTCGAACTCATCGCACCAGTTGTAGACTGCACGTTTGAGCTGCTGGTTTCGGCCGACGAAGAGGTGACAAA
GCTGCGGATGTACTATTTGGCGCGCCAGAAAAGAAATGCCAGCGAGGTGCTGCTACTGTCGGCGTTGATGTCGACGCAGGATTTCCAGGTGAGCCAGCAG
TATCAAAGTGGGGCCGCGTTGCTAGCCTCAATTGCGGCCATTGAGGACATGCGCGCCACCGAAGTTGTGCACCACTTTGCCATGGCCTACAATTACCCCT
ACGAGGATGAACCCCATTTCGCTGTCAGTGAGCTAATTGGCGTCGAAGAAGACAACTTCTGGCTGTTCAAGAGCCAACCCAATGAGGGAAGCATCGACCC
GGTAAAAGAAGTACGTTCGGCGTATCGCTTCGGGGGCTACATTGACGACCCGGTGGCTCAGTCCAACGTTGAAATCGTGCACTGGAATCTGCAAGCCGAT
CCTGCTTCGGAGCTAAGCAACTGGGAATGGCATTCGCTTGCTTCTCTGCACGACTCATGGGCCTGGACACACACGATTCACGGTATTTTCGCAATGGATG
TATTCTTCGATCTGGAGATTCTCTTCTTCGTGATCTACCACCGCGCTCGAAAGGGCCACTTCTGGTGGGCGACGCGTTTGCCACCATTTCCAATGCACTA
CTATATCGTGGCGTGCTGATCTTCGCCGCGAACCATCTCAACGGGTACTGGACGCTTACAGAGTTCTGCCTCGCGATCGGCAACGAGGTTGCCGGGCGCC
GATCGATTCATTACCGCCCCGAGATGGTACACGCTGATCTACTAACGTTCTTCATGAACGTGGCCAGCATTTTGAGCTACCTGTTTCGGGAGCGAATCGA
CCCAGTACTGGCATGCACCGCGTTCGAATTCGGCTTTGCGTACCGAGTCGAAATCGTCAGTGGCATGTCCTCACTAAGAAATGTTGTCGCCGGCTTTGCG
GAGAAGGATCACTGGCTTGGACTCATTAATGTTAGTCCGTTCCTCACGAGGTTATCGCCCATGAAGTTCTGGACGGTGCATGAGATCAAGACTGACCGCA
AACCCGTCGTGATTGCCACCGTGCTCTCCATCTTCAGCATGATACTTTGGCTGGTGCTGTACATCATCGCTCGCAAGGCTTACCGCTACTGTAAGCGCAA
GCACGATGGCGCTAATCACCGAGCCAGCCGCTACGCCTCCAAAGAATACGGGTCGGAGGGAGAAGACGGTCTCACGTCGTTCGAGTCAGCCACGGGGTCG
GCTCTGAGCAAGCGCTATGGCGTCATCTCCGGCTACGACAATTACGTCGTTCGCAACGACAAGCGCTATGCATCCATTGATGCCGTATACGGCAACGGGT
TTCTCGTCGCAAATGGTAAGTTCCTCCTTTCAACGGAGGATATTTTCTCGCTGTTGGTCATGAAGGTCACGCGTGTGCGCTTCACGAACATCTACGTGTA
CGCGATCCTGGCGGACGGCGCCGTGAACCAGACAGCTCAGCTCGTATACCCTCACACGATCCCATGGGACGACTTTGGTCGAATTGGTGTCGCCAAACTC
TCGTAACAGGCAGCGAACAGGTATGTAGGGCCTGTCAGTGTAAATGGTGAAGCACAACCCCATATCGCCGCGTGAGGATGTCGATGCGCGCCCGGACATC
CTTCACTGAAAGCCATCAAGAGAGCGTTTCCTGCTCGACTACAGACGTCTTTGGACAGAGAACACCACTTAACGGCAATCGACACGTTCATTTTCTGTTG
TCATCGCAGTGTCATCGACCAGCCTGCCAAACCAGAGGCACAAGGGTCGATGAATGCGTGTGTGAAAGAACACTTCCCCACACGCCCTACCTCTGTCTGT
ACACCTCTTGCTCTGACTCAGCTGCCCTTGGTGCCGCCCTGTATGGTACTTATTTGATAGGCTTGCGCTCGAGGGGCTCACCCTTCAGCACCTTCTCAAT
TTCAGCACCCGACAGCGTCTCGTACTCTAGCAGTGCCTGGGCCAGCTTCTCCAGGTCTCCGTGCTTACTTACAAGGATATCCTTCGCGCGCGTGTAGGAC
GCGTCGCACAGCTTCTTCACTTCATCGTCGATGGTCTTGCGCGTGGTGGCGCTCGTATCGTTGCCACGGAGGTCGTGGAAAACAAGACCCACGTCCGAGC
TCATGCCGTACTTGGTCACCATCGTACGAGCAACATTCGTGGCCTGCTGGATGTCAGACGACGCGCCTCCCGTGATCTCTTCCTCGCCGAATGTCAGTTC
CTCCGCCACGCGGCCGCCCATACACACATCCAGCCGTGCCAGCAGTTGCTTGCGTGAAATGGACGTCTGGTCACCCTCCGGCAGCTGTGAGACCATGCCC
AATGCCTGGCCGCGCGGCATAATGGTCGCCTTATACACGGGGTGAGCTCCTGGAGTGTTAATAGCTACCAGCGCGTGGCCTCCCTCGTGGTAAGCAGTAA
GCTTGGCCGAGTCGGGTGTGATCAGCGCCGACCTGCGCTCCGCGCCATGAGGACTTGTCCTTGGCGTATTCGAAGGCATCCATATCCACCACATCAGCAC
TCTTCATGGACGCGCGCAGAGCAGCCTCGTTCACGAGATTGGACAGCTCCGCACCAGACATGCCGGGCGTCGCACGCGCGAGCACGTCCACGTCCACATC
GTCTCCAAGAGGGATCTTTCCAGCATAGAACTCCAGGATCTCCTTGCGGCCAGCGACGTCGGGCAGATCCACCGTCACATGACGGTCAAAGCGACCTGGA
CGGATGAGCGCGTTGTCCAGCACGTCGGGGAAGTTGGTGGCGCCGATCACGATTATACCCTTGTTCTGGTCGAAGCCGTCCATCTCCACGAGGAGCTGGT
TGAGCGTCATCTTCATGGCCTGCTGCTCCTTGAGTTTGCGCGTGCCGCCGATCGCGTCGATCTCGTCGATGAAGATGATGCACGGAGCCTTCCGCTTGGC
CGACTCGAACAGGTCGCGCACGCGGCGCGCGCCCACACCTACATACATCTCCTCGAACTCGGAGCCCGACGAGTAGAAGAAGGGCACACCGGCCTCGCCG
GCAATGGCACGGGCCAGAAGCGTCTTGCCCGTGCCTGGTGGGCCGGTGAGCAGCACGCCCTTGGGCAGGTTTCCTCCGAGCCGCGTGAAGCGGGCCGGGT
CTTTCAGGAACTGCACGATCTCCTCGAGCTCCTGTTTGGCCTCAGTGGCCCCCTTGACGTCGCTGAAGCGCTTGTCGCTGCCGGTGGGGCCCATGACCTT
GGAGGCCGAGCCAATCTTGCCCACCTTCTCGTCCAGCATGGCCCCGAGGGCAGAGACCACGAGGAAGGCCACGCCCAGCGTGCGCAGCGTTTTCCACATG
TTACTCTTGAAGCTGCCTTCCACCATGGACACGAAGACCGGGTCGTGGGCCGACTGGCCCTGGCCATTGCGGGCCGCGGCCTGACTGGCGGCGGCCACGC
CTCAAACTGTCGGGCCGCGCAACCGTGCCATAGGCCTGCTCGACCGGCTGGGCCAGCTGCGGAAGGTCGACCGTATCCAAGCGGCCCGTCTTGACCAGGG
CCTTGATATACTCCTTCTGCACGGCTTCGTCCAGCGCGAAGCGGTTCTCCTCCACGCGACGCACCACGAGGGCCGGGTAGTTGCTGCGGTTCAGCTCCTG
CAGGAAGCGCAGCTGCGCGTACGCGTCCTCGGGGCTGGAGTTGGCCGCCTGCTCCAGCGACTTGAGCTGCTTGAGCTTCCCGCGCTGCGTCATGTTGAAC
AGCGAGCGCTTGGCGCCGGCGGACGGTACCGGCCGAGCGAAGGCCGGGGCGGGCCACGCACGCGCAGGCGTCGACAGCACACTGGCGCGACTGGCTGCGC
GCTGAAGGAGCAGCAGGCTTCTTGGCCGCAGGACGAGCATGAGGGCTTCTGGCTAGGCTGCGTGTTTTCTAATGAGCGTACAATTGTGTGTACAAACACC
ACTATGGTGTGTGCCACTTCGTTTTGAGGAATGACGGTCTGCCGTTTGCCCCGTCACCAGAGGCAAGCACCCGCAGTACGATACGTTCGCTAACGGTGGT
GGCGGCGAGTCCAAGCAAAGGCTGCAGGACGCAGCATTCCAGACGCTGACATCTGCAAACTACTGGCGGAGAAGGCCGTGGTGCTGGCGGCGAACAGTGC
CGATATCATTGCGAGCGAGGCGGCGAACCGGAAGGTACTGGTAGAAGGTGGGAAGCTGGCAGCTACTCGATACGACGGTGCATACCAGAGACTTGTACTC
GCTGGCAGCATCTCCTACAGGATTATGCTAGTTATGATGGCGAGAACCAAGCAGCCAAGGACAGAGACGTTGACCGACTTGTCGACGAGGAGGAACGGGA
AGAGGGTCGCGTGTCGAAGGAGCAGTTCTCCAACTACCTTGACTCGCTGGGAGGCATGAAGGTGTACATTTTCCTGATCGTGGTGCAGACGCTGTGGCAC
GTGTGTCGGATCGGTAGTGACTTGTAGCTGGACCGGTCACGGACGCCGACATCTGGTCGGCACTGGAGAAAGTGGACATGAAGGCGCAGGTGTCGGCGCT
GGAGCGCCAACTGACGTACGAGCTGAGTGAGAACTTCAGCGTGGTCGAGCGCAGATGCTCGTGCGCTGCTGACTGGGAGCCGCATCGTGGTGATGGATGA