Description :
From Genome Similarity Track
Location :
Scaffold_59:42956- 46895
Transcript NameFunction/comments
Sapdi_VS20SDRG_13355hypothetical protein
Sapdi_VS20SDRG_13356CAMK/CAMKL protein kinase

Sequence
3939 bases(100 bases per row)
GCTGCACCGTTCGCATCAACGCAAGAGCGGTTCGAAACGACCTTGACCAAGGAGCACTTTGACGTTGGGCCCGGCTCATACGAAGCGTCGTCGATCGTCA
AGGAGCTTTCGCACAAAACGGTAGCACGTTTGTTGATGGCGGGTTGGAACTCGCGCGTTAGAGTGGACGGGCGGGCGTGTTTGGTACCACCACGCGGCGG
TTTGAGGCGCCAAAGTCGAGCTCCGATGCCCTGCTTGAAAAGATCCTCGAGCACAGTGCCGGGCCTGTCAGCAGCAACCAAGGTACTTGTCGCTCAACGA
GGCGTGCGAAGATTCGTGTGGCGCAGAGTCGACGTCCCCCGACAACCACGCCAAGAAGAAGACATCGAGCTTCGCGTCGGGCACGGCCCGCTTCGCCGGC
GGGAAGAAGGATGCGGCTCCGTGCGTCGGCGATTATGAGGTGCGCATCGTCTAGCGTGATCGAGCCAACGATGGCATATCGCATTATTGCGCAGATATCC
ATGTCCTGGGACAAGCCGGGCGGCCGGTCGACGTTCGCCTCGCATTTGACGCGCGATGTCTCGCAAAAGGACAAGCTCGCAATCCCGGTACAACTCCTTT
CTTAGTCGTCGCTCAAGGGTAAATAGGGCCCCGGCGCGTACTCGACGCCCGACGTCGCCACGCTCCAAAAACCACAGAACCGACGTGGTGACGTGTTCGT
CTCGACGGTTCACACTGTGTACGCCATCTTGTTCTACCAGGATGCATTAGGAGCCGCGTTTCAAGAAGACGCTTACGCCGCTCGCCAATGTGGTAAGCTC
TTTTGCATCATCTTTTCATTTTTTATATTTTTGCACTTTGCATTTTCGTGCAATTTGGGTGTCGTACACACGTCGAATGATGTTCGTCGGCCATCATCGC
GACAATGAATGTAAGCGTGATGCTTGGTCTTGTAGGGCCCCGGCGCGTACAACCCCGACACGATCGAGTCGGACTGGAATCGCCCGACGTACAACATTAC
GATTGCCACCGAGATGGAACGACGCTTGGCCTAAGACCAAGATTCCAAGCTCGCACCCGATGCATTGGTGCGCCCGCCCATGTACTCGACAAATAGAGCA
GCGTCAACGTCCACCCTAAAGTGTGTGTGCATGTTTCCTTCTTGGCGCGCAGCTGAAGCGTTCCGGCGTTCCCAGAAGAAATCTGACATTCGCAACCAGA
AAACCAGAGATGAACGTTGTCGTCGACGCGGCCCGCCGCGGTGCGCAAGTCCAAAACTTGGCGTCGTAATCGAGCATATCGCAGCGTCAACTGCAACGGG
CTGTCCTGTTCTGTCCAGTCCGCGCGGTTCCGCGACCGAGAGTTGCACCGAGGGAATCCACCCAAGTTTCAAAATTTGTTTTCGGTCCCACGTTGGCGCC
ATGGCGGTCGCCAGCACGACGTGCCACACGGGTCAGCGCACGCCACCGGCCTCCTATCCCGCACACCGCAAGGCATACGTACATACAATAAATAGCATAT
TGAGAGAGCGCTTGGATGTCCGTCGGGCTCTGCTTCAAGTCGCGCAACAGGACATGGCCTGGCACCAGTTGGCGTGCGTCCAGTACATTCTGTCCGAGCA
AGAAGGGAATTGCCCTGTCCACCGCCACCTCGGGTACAGTGGGACCTGTTGCACTGAGCGCCTGCGAAAAACGCAGGATGGGCTTGTGCAAGACAGTGGT
CGTCGCAATCCATACACTGTATTCTCCGCCACCATCAATTATTCTGGTGTTGGATCCAGTATTTCAGTTTTCAATTTCACTTGTCGAGCACATTTCAACG
ATGAGTTCGATGGACCGCTTCATTGTTCAGCGCGAGATCGCGTCGGTCGCGTCCGGCAAGGTGCTTCTCTGCACCGACAAGATGACGCAGAAGGACGTCG
TTGTCAAGCGCATTCGCCACACGTCGGGCCCCGAGAAGGCGATTCACCGCCACTTGAGCAAGCTCGGCGGCCACGAGCATGTGCTCCAGCTCCTCGGCGA
CTTTACCGAGGCTGGCTACGACCACTTTGTGCTCGAACACTGCCCGAAGGGCGAGCTCTTTGACCTTGTCTCGCGCGCTTCGCGTCTCGAAGCGCCGATC
GCGCTCCACTACTTTGAGCAAATCGTCGCCGGCGTCGCGTTCATCCACCGTCGCGGCTACGCGCACATGGACCTCTCGCTCGAGAACGTGCTTGTCGACG
CGCAGGGCGCCATGAAGGTCATCGACTTTGGCCTCGCGGTCGCCATCGACCGCCCGCAGCGCAACGCGGTCGGCAAGTACTTTTACATGGCGCCGGAAAT
GTTCACGGGCGCCACCTACGACGCCGCAGCGGCCGACATCTGGTCGCTCGGCATCATGCTATTCATCATGCTCACGGGCAACCCGCCGTTCTCGCAGGCT
GTGCCCTCGGACGCGGTCTTTGAGTATGTCGCCAACTATGGTCTGCGCGCGATTGCGACATCGTGGAAGGTCGACCACTTGATCCCGGCCGCGACCATGG
ACCTCCTCGAACAAATGCTCTCGATCGACCCGGCGGGCCGCCCGCGCATCGACGACATCCTTGCGGCGGTCACGCCCGTCGTCGAGACCAAGCCGCACAA
GGCGGAGAAGGCGGCCAAGCACAACCACGTCCGCGCGTTCCTTAAGAACGTCTTTTCGCACTCGTCCAAGAAGGTGGCCGTGTGGCAATGAGCTGCGCGC
CTTTTAGGATTCTTATTTATCGAGCATTAGTCTTATTCTAGTTATTATCTATCCATCGAATTGTTTTCAAGTACATGAATGGTGTTGTCCCGGAGCCGCA
GCAGTGGCCGTGAGCAGTGGCCGTGAGCAGTGGCCGTGGCACCTAATGCATCGCAACCGAGCTGGCGGCGTCGGCTCGAAGCGACACGCACGACGAGGTG
GACAGGATGGCGGCGTCGCAGATGTGCGCGACGAACGAACCGCGATGTCCGATGAACTTCATCACGCGACCGCACGCTGTTTCGTTATCTCGCGGGACAT
GTGCACGGAGCGCCCGTCGCCCGCGTTGACGCAGCAAGCGCTTCGCGTCAACACATCTTGGCGTCAACACAGAGTCTGGTGCCAGAGATTCTGGGTTAGC
CACTGGTTCAACCGCTGGATGCGCATCCACTGGAAAGGCCGAAACCATCGAACGTCTCAGTCGGAGGAGAATCTGGGCGGGTTGATAGCTCCTTCAATCC
CAGAAGCTTCGCAGCCGTGCGTTCGACATAGATGGGCCACGCAGTTGCGGCTCAGATTCGCCAAATCGTAGTCGATGCCGTCAACTAACTACGAGTCGAC
ACACTGCGGATGACGCGATGGATGACGACGTCCCGCAGCTGTTGATTGCGCCTCGACGATTGCGCGCGCTCGATCACGCCATGATGCGCCTGCGGAATCG
CAACGGCCCTTTGCGTAATCGCGTTAAACTCGAGTCCAAGAGGAGGCTAAAGACAAATGTTGGTCGTTGTAGTACGCAACAATGACCTCTGAAACGCCGG
TCCCAACCAAGATTTGATTCCCTTGGTTCCTACGGCAGGACGCACGGCAATCATGTATGCGCCAGCGTATACGTGCGTGCAAGCATGACGCGAGTGCGTT
CGCCAGTCGGCCGTCGGACGCACGAGCACTGGCTTGCACCGCGGTGTAATGACCGGTGGCGGTTTTGTGCCAAGGTACGGTCAACGACATCGATCTCAGT
CGCGTGCGCGCGTCAACCCAGCGTCGCAAGATCCGCACGTGAGCTCAAAGCACAATGCGTTTTACGTCACGTCTCGTCAACGTTGGGACTCCCACAGGAC
CAGGAGGCAGCCTCGACCCGGCCTGGTTACGGAGATAAGTCAACAATGTATAGATGCAATTGATATGGTACTGTCCGTCGTCCAGTAGAGATCGCGTACA
AGGTTACATCTACCGCTCTCGAACCTGAGTCGTTCGCGC