Description :
From Genome Similarity Track
Location :
Scaffold_79:42950- 45939
Sequence
2989 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGATACACCAATGGCTACATACATTTACGATCACCACGACGGGTGGTCCATGCACATTTAGGATTTCAATTGGCTGAAA
GCAGCATCTTTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAAGTC
AGAAACATAAAACACATATAGCAGTTCTCATCTTTTACCAAAACACGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACT
TAACTCAAGTAAAAGAAACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAAGTAGGCCCACTACACCTGGTAGCACTTT
GTAGTCCGTCCAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAAGCT
CCACTTCGCCTGCAATACATGTTGCACGCGCTGACTGCCTCCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCATTGGAAAAGC
GGCTGTAGCTGCAATGCTGCGCACACTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGATTCATCATGAAGGAGCAGCGAGGTGCTGCTTCGTCTACC
ACGGTGTCGTCCCCGACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCG
AACTTGACATGCCATTGCGGCTCGACGTATCGTCGACACGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTAT
GGACGCCGACTATCTGATCCTGCGTGCTTCAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGGCAAGCGTTTGAGCCCCCGCAAAATGAGTTTCGATCGA
GGGCAGAGTTCCTCGACCTACAGCAGGGGAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGA
CGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTCAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATT
ACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAG
AACCCATGGACCTCTCGAGTGCTGCAACTGCCGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCTCTTTGCTCG
GGAGTGCACGTCCGTGCACCAGCAGGGTGGCTATCACGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCC
CTACTGGTAATGCAGTTCCGCGTGTCGACCTCGGACACGCGACATTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAA
GCCTGACCTTGTCATCCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGCCTGCGA
AGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGG
TACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACAATAAGTTTGACATTGTATTGGGCATGCCGTGGCT
TGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCAATCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCAC
GCACCGATAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGGGCGCAAGAGCAGCAAG
CGCCGGCGTCACCGCCGACGGCTCAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGCCTCAAGGGG
CGCGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGACCAATAATAAGAGCCAAGGTGACGTAACG
CCGTCGACTCTGGGAGTCGATGGCTTGGTTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTC
GAGGTGAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTTGCAAACGTCCCGCACCGGAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCAC
GACGAAGCGCCGGGCGACCAAGCCTGGCTTGAAGTCGCTCGCCCGCGGGATGAACCACCCGGCGGTACTGAAGATCACCCGTCCACGGCTGGGCCTGGAC
GAGGTCAAGAACCAAGCGGAGCCAGGCTCCGCAGAACAAGAAGACGGCGCATGCAAAGGTTGCTGTGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGA
AATGTCTGCCGGGCAGACGGAGGCAGAGAAGCCGGGCGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTC
GCTAACCCTTCGACACAAGCATCGGAGTTGACTTCCCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATAT
GCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACC