Description :
From Genome Similarity Track
Location :
Scaffold_163:42942- 46587
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_163-snap-gene-0.22Pumilio-like mating protein M90
Pytir_DAOMBR486maker-pir_contig_163-fgenesh-gene-0.15Amine oxidase

Sequence
3645 bases(100 bases per row)
CCGCATCCAAGTTCGCTCTATCGCTCCAGGTCTGGATCCAGTCGACGAGCTGACTACGAGATGCTGCATCCTGTTGCACACTCGTACTCATCGACCAGTC
TTCTCGAAGAGTTCAACTCGGCTTCCAAGTCTGACAAGTGGGAGCTGTCTGCTATCAAGGGGCACCTGCTGCTATTTGCCAGAGATCAAAGCGGCTCCAG
ATTCATTCAGCAGAAGCTGGAGAAAGCAGACGAGCAAACCAAGGATGACGCTTTCGAAGAAATATTTCCCAACGCGCTGGTTCTGATGACGGATGTTTTC
GGGAACTACGTCATCCAGAAGTTCTTCGAGCACGGCTCAGTGAAGCAGCAGCAGCTTTTGGTAGAGCAGATGAGAGCCAACATGATCAGCCTTGCTCTTC
AAGTGTACGGCTGCCGGGTTATCCAGAGAGCGCTTGAGGTCACTCAAGTCGAGGAACAGCTGGCTCTGATCAAGGAGCTGAGAGGACACGTTCTGAAGTG
CATCACTGATCAGAACGGCAACCATGTTCTTCAGAAATGCATTGAAGCTGCGTCTTGGAAGCGAAGCGTTGAGTCGGGCGAGAATCTGGAAACGCGACAG
AGAGTCACCGGTGAAGACGTTCAATTCATTATCGACGACATCGTTGGGAACGCGGCTGGGTTCTCGACCCACTCCTACGGCTGTCGCGTGATCCAGCGCA
TCTTGGAGCACTGCTCGCCAGCCCAGATTCGCCCGATCGTGAGTGAGATCGTTTTCAAGTGCCATGATCTCGTGAAAGACCAGTTTGGAAACTACGTCGT
CCAGCATGTCATTAGTCACGGCGAGCCCGACCAACGGCGGGTGGTGATGGATGCTGTTTTCCCGGAGATTGGTCGATGGAGCCAGCACAAGTATGCGAGC
AACGTCGTGGAAGCCTGCTTGGACCGCGCAAGCAAGGCTGAAATCGCCCGCACCATCGACTTCATTTTGCAATGTGATGAGACTGGGTCGTCGTGCCCAT
TGCTTCCGATGATGAAGCATATGTACGGAAACTACGTCGTCCAGAAGCTTCTTGATAAAGCTGACCCGGCCGACTGTGAACGGATTATATGCATCATTCG
ACACAACGCCGACTACCTCAAGCGATTCACGTTTGGGAAGCACGTGTTGAGCCGCTTGGAGCGCGAGTCAGCTGCGAGTCACTATTGAGATGCTGTAAGT
ATGCAACTCGCAGCAACATCACATCGTCGAGTTGAAACCAGGGCGGCGCAGCCCCCAAGAAGCACAACTTCCAGAACTCAGCGCACGAAGGAACAAGACT
GGAAGAGAATATCCGTTTTATGCTTATAAATATTTGACTTAGGTATTCGTACATGTGACTTGAGTGAAGAGTGAAGATTTAGGTTGGCATAATGCATAGC
AGTTCAATAAATGCAACCACCATCAGTTTCGTGTGACTCCTTAGACTTCGCAGTGCCCTACGTTATGCCCGTTCACGTCTGGTCACAGAAGCAAAACTAT
TGGACAAACATGCAATCAGAAAATGTATTCGATTTGTTTGGTTTGTTTCCTCTATACACGCAATGGTCTCAAAAAAAAGAAGCGCCAATCTGCAGAAGTC
TACAACGATGCCGCTACTTGAGCTGCAGCGCGAGTACCCGTGTCCATGGCGCTGTGCACCGACATGCCCGGCTGCTCGAACGACGTGGCTTCACCCGCGA
AGAAGATGCGCTTCTCGATGGCTCGCGCGAGGTCGCTGGCAGCGGTGTCCGATTGCCCCACGCGAGGAAAGCTGTAGCCACCGCGGATGTACTCGACGTC
ACCCCAGTCCACGTACTTGCCCTTGACGAAGCTCGAGCGCGCAGGCGTGGGTCGTTCCTTCGTGCCGTAGATCATGTCGAGTTGGTCCAGGAACTTCTCA
ATAATCTCTTCCTGATTGAGAAGCTTCAGGCGGTCCGCACAGTCCGAGCCAGCGAAGCCCGTGACCAGGTACTGCACCTCCTTGTTGGCAAGAGCTTCCT
CAGCGTAGAGCGCCTCGGCAACAGCATCTCCGTTCAAGATGAGGTGGCCCACGCCCTTGGAGCTGTTCACCCAGAACTCGGGCAAAAAGCAGTCCGAGCA
GATCACACCGTGCGCGTTCTCGGGCCAGAACGAGTTCGTAAAGTGCATCAGCACTTTCGCCGCGCGACGCATCCCGTACGAGTCCACGGCGTCTGCCTTA
GCTTGCGGCAGGCACGGCACGTACTCGATGTCTTTGAACACCGACGTCGGCACCGTCACCACCAGGCGTCGGCAGGACATTTGCTCTCCGCTTTTGCTCG
TGAGCACGATGCTGTTGGCGTTCGAGTAGTCGATGCTCGCCACGGGCCAGCTGAGCTGCGTGTCGATGCCCGTCTTGAAATGCTCAATGATGCGTCCGAA
AGTGGGCACGACGCGGTAGTCGCCCTCGTCTTCGAGGTCAATCCACTGGCGCTCGTACTTGCAGGTCACACGCAGCGAGATGTCCTCGAGGTTGCTACCG
GCCGTGTTGGCGTATCCTGCGTCCGCGAGCTTCATCATTGACGCCGAGAGACTGTAACTCTTGAAGTAGTCCATCATGGACTGGTCATGTGGGATCGCAT
CCACGTCTTCGATCTCGCTCAAGTGCGAGACCGCGTCGTTGAACTTGCAAAAGTCTGGGTCCTCGTCATCGAACGCGAGCATGCGCTTCTGGTCGCCCAG
GTAGTAGTAGCCAATACCTCCGTCCGGCGCTGGATCAGTCGGACCACCGTCACCCTAACAATTCATCAGCAGTGTGAAAATACCAACAGACAGACAGACC
GTTAGTACAATACCGTGTAACGAGATCGGCAAGAGGTACGCGTTGGAGAGACTTTGAATTTAAATCGTGTCGAATTGGTTGACGTGTTATATAGATTTTG
CTTTGCTTTGTGCTTGAAAGTATGTTTGAAACCAGACTGACTTCGCAAGGTGGACTCATACTAAAACCAATGGCCAAGAACTGGTGACACCGGCAGCATG
AATGAAAAGCCGAAGCCTCTCGCCTTGCGATGCTAATTAGGTAACATTTGATATTGCATACGTATGAAGGCCAAATGATTACAAGAGCTCGCGCACATGT
AGTTTGCAAGCTAATCATAGGCTGATTAATCGATGCGAGACCAGAGCGCTCGGGTCAACGAGACTCTGGTACTGAAACGGCTCCCCACACATGCAATGTA
CATAGATCAACAGATGTCTCCTCATTCCACACACACTCGTTCGGTCATCTCACCTGAGCCCACGTGAAGATCTCCCGCAAGCCCCACTTCTGCTCTTCCG
CGAGTCGAGTGAGCGTCGTGTTGGCACCGTGAAGCAGCTCTGCACCGATTTCAACCGTCATACCAGGAATGAAGTCCGTGTCTGGAAGGATGCGACCGCC
CACGCGGTCCTGCGCGTCCACGACCAGTACGTCTTTCACTCCCTTCTCGTGCACAAGCTGGTGCGCGCAACGCAAACCTGCGACGCCCGCTCCGATGATC
ACAACGTCGTGACGCTTCAGCGCACTCATGATGCCTCCTTCTTTTCGTAGAACGCTGGACGCCAGAACGTAGCAAATGCTCAATGAGGGATGAAGGATGG
AAGGAAGCGACCTGAGGGGCTCATTTCGCGAGCTTTTTAAGCAGA