Description :
From Genome Similarity Track
Location :
Scaffold_556:4294- 6167
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_556-fgenesh-gene-0.3Serine/threonine protein kinase

Sequence
1873 bases(100 bases per row)
CCTCGCTCGCCTCTCGCCGCCGACCTGCCTCGCTCCGAGCCGAACGGCCGCCTTGGTCAAATTCGGGCAGGGGAAGCTGCTCGAAGTGTCCCAAGATAGA
GTTTGTAACCTCAGGTGGTCGTCCTCATATAGGGTGGATGTGCCTTGTTTAGGCTGATTTTGAGACTCGATGTACCTTAAACCAGTGGATATCCTTGTCA
TTGTGGCGACTTTGGCTGCTGATCTCGACATGGACACCAAGCAGGTCAACACGGACGCGCTGGCGGCCGCCATGGCCGAGCGGGAGGCGTCTCGCGCTGC
TGCCGCCGAGCACTCGGAGGACCAGCGCATGGACCAGGCCGAGGCGGAGGAGGAGCGCCGCGTCGTCAAGCTGAGCGAATGCGTGGAGCTGGACCGCGAC
GCCGAGGTATCTCCTTCCTCTGTCCATTTCCAACAGTCCTGCGCTATCCATTGCTTACACATTGTATGCTGCTCCTTAGGACGTCTACTACGTCGGGACG
TCCGGACTGAAGATCACCGAGCTCGACGGCCTCGAGAACTTGCCGCGCCTGCAGGTACGGCATCAATGTATCCCTCTTCGCATCCATTGCATTGGTGGGA
ACTAACCAGACGAAATGACGCAGAGCCTGCACGTGCGGTCGAACCTGCTGACCTCCATGCGCGGCGTCGAGTCGCTGGCAGCGCTGGAGCAGCTCGAGCT
GTACGACAACGAGGTGGAGGCCATCTCGGGGCTCGAGACGCTCACCAACCTGCGCGTGCTCGACCTGTCGTTCAACCACATCCGCCACGTCCCGGACCTG
CGCCACCTCGCGCGGCTCGAGGAGCTCTACGTGGCCAACAACAAGCTCAAGAAGATCTCGGGCGTCGCGGGGCTCGCTGGCCTCAAGAAGCTCGACCTCG
GCGCCAACCGCATCCGGACGATCGAGGGGCTGGACGGTCTGCCGAGTCTCGAGCAGCTCTGGCTCGGCAAGAACAAGATCACCAAGGTGCAGGGCCTCGA
GGCGCTGTCAAGCCTGAAGATTATCAGCGTCCAGGTATGGCGTCGTCCCAATTGGTTCACGAGGGAATGGCATTGCTAACGCGGTGTGGTCGTCAGAGCA
ACCGACTGGTGACGATCGAGGGGCTCGAGCACAACCTCGCGCTCGAGGAGCTCTACCTGAGCCACAACGGCATCGAGAAGCTCGAGAATGTCGAGCACTT
GGTGCGTTCATTGACGTGTGGTGGACATGCGTGGTATTGATAGTACTCATTTACCGTTCGTGTGTCTTTCAGGCCAACCTGACGGTGCTGGACGTCGGCG
CGAACCGGATCGCGGCCATCCCGACGACGCTGCGGACGCTCGCGGCGCTCGAAGACCTGTGGCTGAACGACAACCAGGTCGAGCGCTTCGCCGACGCCGA
GCACCTCGTGCCGCTCGCAGGCCTGCGCACGCTCTACCTCGAGCGCAACCCGCTCGCGCGCGACTTTGAGTACCGCACCAGGCTCGAGGCGCTGCTGCCT
GAGCTCGACCAGATCGACGCTGTGCCGACCAACAAGGCCCGGCGCGGCCGCGGGTAGTCAGTCGCCCATCGGGTATTCCCCATATCGCGCAGACTAATGG
AAACTGTTGACAGCGATCTCCCACTCGCATCGGAGCCATTTGCACCGCGTCGCTCAGCCTTTGGTCGCTGTCACGACTCCGCCGCGCGGGTCGCCGTTGG
TCACGTAGACCTTGGGCGGTGGAGCCCGCAGTCGGCAGCTCACGGCCGAGCACACGACGCACAGCTCGCCGACGAAGACGACCCACGAACCGCAGTGTCT
GCACCGCTGGCCGCGCAGTTTTCCCTTGTACACCGGCACGGCCAGCACCAATAGCATCAGCACGAGAACAGCG