Description :
From Genome Similarity Track
Location :
Scaffold_16:429329- 457616
Transcript NameFunction/comments
Phyra_42448ATP-dependent RNA helicase, putative
Phyra_76189integrator complex subunit, putative
Phyra_76190prolyl-tRNA synthetase, putative
Phyra_94409Hypothetical protein
Phyra_76192Hypothetical protein
Phyra_76193Hypothetical protein
Phyra_76194Hypothetical protein
Phyra_76195putative E3 ubiquitin-protein ligase HERC2
Phyra_76196Hypothetical protein
Phyra_76197Intraflagellar Transport Protein 140
Phyra_76198peptidase putative
Phyra_94413PREDICTED: ankyrin repeat domain-containing protein 24

Sequence
28287 bases(100 bases per row)
AGAAAGGCAAGAAAGTCGGCAAGTGCCCGTTCTATGAGAAAGAGCTGCTCGGTCACTACAAAGACTATGCCCTCGTGAGTCTCGTGTTTTATTTATTGTT
TTTGGTGCCTGAGTGATTAACAAGTTACCGTTTGTGCAGGCTGAAGTGCAGGACATTGAGGACCTGCACACGCTGGGTGAAGAAATGTCTATTTGCTCGT
ACTACGGCACTCGTGAGAGCATCTCGCTTGCTCAAATTGTCACGGTGCCGTATTCCATGTTACTGAGCAAAGATACCCGGGAGACACTGGGCATTGCACT
GGAAGATAACATTGTCATCTTTGACGAGGCGCACAACATCATTGATGCAATCAACAACACGTACAAGGTCGAAATCACCAGTAAGCAACTGGTCGTCGTG
CGACGAAGCCTATGGTCTTATTTCTCGAAGTATGAGAAGCGCTTCAAGGGTAAGAACGCGTTCTACATCAAGCAGCTGCTGTCGATCTTGGAGTGCTTGA
CGAAATTCCTTCGGCAACTGAGCAAGTCTGCTGGAAAATCCTCATCGACAGGTGACGAAGACGATGGCGCCCCAGGAGCACAGATGCTGACAATCAATGA
TTTCTTGTTCAGTGCTCGGATAGACCACTTCAATATGTTCAAGATTCTGGAATATCTAAGGGAAAGCGGTCTGGCAAAGAAGTTGATGGGGTTCGTCGAG
TCAGCAAACGCTGGCGCTCCTGCAGAGGCACCGCCGCCACAATCTGTTTTAGACGATACAGACGAAGGCTTCCAGAGCCGGCATATCTCGCCACTCCGAA
CTGTTGAGGCTTTGCTAAAGGCCTTGACCAGCGTAGGCGGCGATGGCCGTATTCTCGCACAACCGCATAATGTAAGCTCTGAAGCCCTGTTTCGACGTCG
ATAACGTGATTCCTAACTATTGTTTCTGTGCCCAGGCGAGCAAAGGTGTTGAAGGTTTGATAAGGTTCATTTTGCTCAATCCGGTCATACATTTCCAAGA
AATCGTGAGAAAGGCACGGAGCGTCATCCTCGCCGGAGGAACAATGCAGCCGGTGAGCAATAAGTATTCAAATTTGCAACCCTGTATATAACTAACATTT
AGCTGCACGGTAGGTGTCTCAAATGATCGACCAACTATTATCTTCCGTCCCAAAAGAAGACGTTGATTTGTTCTCCTGTGGACACGTGATTCCCCCCGAA
AATCTGCTTGGATTCAGCCTTACGTCGGGTCCTTCACAGAAGCACCTCGAATTTACGTACTCTCGGCGAGGCGATATGGAAGCGCTGGACGAGCTAGGGC
GCATCCTACTGAACCTTTCACGCATTGTTCCAGGTGGGGTGGTTGTATTTTTTCCTTCTTACCGGTTTGAAGAGAATGCAGTGCATCGATGGAAAGCCAC
AAACCAGTACGAGCAGATTCAAGCAAAGAAGACCGTTTTCAGCGAGCCGAAGAAGTCCGATGAACTCGCAAATGTGCTAATGCAGTATTCTGCAGCGTGC
TCTCAAAGTAACCGTGACGGAAGTGGTGCGATGCTGTTGAGTGTGGTTGGCGGCAAAATGTCAGAGGGAATCAATTTCAGTGACGAGTTAGCTCGATGCG
TTGTGATGGTGGGGATGCCCTATCCAAATGCCCGAGATGCAGAGCTCGTCGAGAAAATGGCTTTCCTAGACAAGAAACACCCGGGATCAGGGCGACAGTT
CTACGAGAGTCTGTGCATGAAAGCGGTCAACCAGTCAATTGGTACGTGCGATTCTGGTATGCTTCTGCCCCTTCCTCCCTCTAATCCGTGTTCTCTTCGC
AAACTTTTCAAACACAACAGGAAGGTCTATCCGCCATCAAAATGACTACTCCACGATTCTGCTAGTTGACCATCGATACGCAAGCCCAGCCGTCCGCAGC
CGCCTGCCAGAGTGGATTCAAAAGCGCGTTCAACCTCCATCATCAGCCAAGTCGTTTGGACAGGTGTACTCGCAACTCGTGCAATTCTATCGAGCGAAGG
AAAGCCAGGATCGTCGACCGGTCGATAAATAACACGAAGTCTTCACCACCCAAATTCCTATTGAATTCCTTACAATAGATCTGCAGCAATAGGTAACGTT
GTGATGAAAAGAAATACTTCGACGAGGGTGCCCGAGAGTGTATGTGACGGCATATCATACAGACGTCAGCTTGAAGATCATCCTTTATCATTGGGATAAG
CTACTTTGCTAGCTGTTTCTTGTATTCAGCGTGAATGACTTGTTTCGCAATGCCCAGTACTCGACCTGCAAGAGCTTCGTCGTCGTAAGACCATTCCATG
TGCACTTCCCACTCAGTAGACACTGACACTCCAACTGTACGAAGCTTCAGCCAACGATCAATCTTCTCAATGGCAAGATGGCGAATCCACTTGATAAGAC
TGGCCTCTAATGCTTTCAGAAGTTCGCCCACATTCGCTTGAAGCTGCTCCTCATTATCATTATCTTCATCAGCTGACTCAACTGCAGCTGAAAGTAGAAA
AGATAGAGCTGATGCGGGGCGGGAGCTTTTCTTCTTCACCCGAGGCGAAGGCTCGAAGGGCTTCTTCCAGGAGTACGAGAAGAAAAGTGAGTGTTTCTTC
TTTTTCAAACGCCGTGCGCCATTGCCAGCTGACACAAGCATCAGCTTGCGCTTTGGCTCAGCAATCAACATACCCTGCACATCCGAAGGGTTGTTAAACA
TAGCCTTGTGAATGCGTAGCGGGATATCCCGGGCAGGTTCAATGGGAGTTCGCCCTGTAGGATTGACCCCTTTCACAGTCACGCTGGTGTCGACAGTTGG
GTCCATCTTCATCTGGTTCTGGACGTGTGTCTGGACAAATGCCAGGTCGTCTGGGACCGTATAATCGAGAATGACCTGGCGTGGCGCTACGCGTGATACA
AGCTGGACAATGCTCTTAGTGTCCACTTCATCTCCACAAGGTTGGTAGTGTACCCCACATTCCACGTTCACACCTAAGCGCTTGCTAACGCGCTTACGCT
CAGGGTCTGCGTAGAGCAAATAGTTTACTGTGCCCGGTGTGCAATACTCTGATAACACGATGAGATTCTTTGGGTCACTCGCAACCGCCTTAATCGCACG
TAACGAGTCACCCTGAGAAATGTTGGCTGGTCCTGTAAACAGCACGAACGGTCCAGGTTGCTGCAGCCGCTTCCAATCGAACACCTGCAGGTCAGCAGCG
TTTGGAGACCTTTCACGCAGCAAATTTTGCACCGCATGCGTGCACGTGCGCGACAACAGCGGCAAGAACCGGCTTGGATACTCCATGGCCGAGTCCGACA
GGTAGATCGGACACTGCGCCGATTTCCCGGTAGCATCCTTCATCTGTTGCCAGTGCTCCAGCAGAATCGTAATCAACTCATGGAAGTACCCGAGACGGTA
TACAGGAATCACCACTTTGCCGTTCGAGCTGATACATTCCAGAATGACTTTCACAAGCTCCCTTTCCATGGCGCTCTGCGTCTCCGATACAGTCACGGCA
AAGGAACTGCGCGTAATCAGCGCACTCGGTTCCAATCGTGGAATCTGCGCCGGCAGCAGCACTCGGCCACCCGTAAGGTTAAAGTCGTTTGCAAACAACA
CCGTCGTCGTCCCGATCTCCAAGTAAAAAGCACACCCGCCCGCCACATGACCGGAATGGTAAGCTGTTACCTTGAGGTTCTCGTTCACAGTAACACAGGC
CTTCAACGCAACAGCTTTGGCTTTCCTGAACGCCGCAGCAATATCCTGAATGTCGTACGGAGCTGGCAGGCCGCTGCCTCCGTCTTTCGCCTTGCCGTGG
CACCCAGTCCTACAGCACCAAATTGTCAGCACTTTCATAAAATACAGATATTATCTGTCTACAATTTCCTATCCCTCACCAGTATTCAGCCAGCAGATGC
GGCGCGATGGCCCGCGTGCCGTGCGTCATGAGGACCGCTGGAGGCTGTTTCTGGCTCGGATCTTGCGCTGCAGCGGCCGTTGCAGTCGCCCACGACACAC
CGCACTTCTCGGCTACATAGGGCAGCATGTAACACGCTCCGGGGCGGTAATCCGGCACCAGAATGGCATCTAAAATGCCGCCATCGCGTTTCAGGAGGTC
CTTTAGCTCGCGCCGGTACTGCGTTGTCACCGCCTCAAAGTCCTCGGCGCCCGCATCGTCGCCAGAGAAGAAGGACACGTCTTTCGCCTCCCCGCAGCCC
AGGAGCACCGTCGTGCTCGAGAGCTCGTCGCGCAGGCAAAAAGCCGCGCCATTCCCAAGCCTCTCCACTGAAAAGCTCATGGTTTTGTTGTACTATGAGA
GGGGGCGAATGACCAGATCAGAATCTGATAGAGTCTGAGGAATCTGAGTATGTTTTTGTGGGTGTCCTTGTAGACTCAAATTGGTCCTCCGTGACCCGTA
CAACATTTTTTCAGTCTAACCATGTATGCGTATCTATCCCTTGTGGTCCTTCGAGCCTGTACAAGCAGCAAGTGGATGCTACGTCCTGCATCTAGAACTT
GCCAGCTTGAATAAGTCCGTCAAAATAAGCTGGCAGTTTGTCCAGTGGCAGGAACGTTTTCTCCATCGTTGCTCGTGTCTGTACCTCAACGAGGCCTTCC
TTCACGAAGCGCTTGCCAACTACGACACGATACGGGTACCCGATAAGCTCGGACTCGGCAAGCTTAGAACCCGGGCTTTCACGCCAGCGGTCATCCAGCA
ACACGTCGTCCCTGACCAGGCCGGTCACCTTGCCAGAAGCTAGTTGGTCAGCGATATCCCATGCAGCCTGGGACACGGGGTCTTCCTGCTTCTTCCCACC
GATGGACATGACGAGGATCTTGAACGGAGCGATCTCGGTGGGCCACGCGATGCCGCGGTCATCGTGGGAGGCCTCCACTGCTGCGGCCACAAGCCGGCTA
ACACCAAGGCCGTAGCAACCCATCTCTAGCGGGTGCTTCTTGTTCTTGGCGTCTGTGTACGTCGCTCCGAATGGTTTCGAGTACTTTTGGCCCAGGTAGA
AAACGTGGCCTACCTCGATACCGCGCTTGTCCTCGAGCACTGCAGCGTCGCCGCCATTGCAGCGCGGGCAGTGGTCACCCGCCTGAGCCAAGCGAAATTG
GCCCCACACAGCGTGGGTACGCGTCTGTTGCTGTGGCAGGGCCTCGACAGCCGCACAAAGAGCTTTCACGGCACGGGTAGCGTGCTCATTATGCTTCAGT
GAATCATCCAGAAGCACATGCAGCTCCACAGAGGGAAAATGCCCGCCCAGTAGCTCAGCGATCTTCCTTGTGTCCTTGATCACTTCGCCTTCGTCACCAC
CAATAAACGGCTTGATTGCAAGCTCATTTACCTCCCTGTCGTGTCGAGCAAAGCAAAGAGCCCACCGGGGAAGAGACTTATCTTCCTCCTCGTCGTCGAA
AGCCTCAGAGTCACAGCTCTCCACCTGCTCCTGAACCAGCTTAACCGAAAACCCGTGGTCCTCTGCTGCCTCCTGAAGGTCCATCACAGTCTTCCAGACC
TTCTCGTCTCCAGTTCGAGCCTGTTCCTCGAGCTGCGCAATGATGGCGCCAAGCTCTGTCGAGATCCCGCCATTTACCGTCTGCTCCGAAGATGGCAAAA
GCCCCTGCGCTTTCTCCACATTCGCCGCATAGTCACACTCTGCCGACGAACACGACAGAATCGCGTCTTCGCCGATATCAGCCAGCACGTGGAACTCGTG
TGAGAGATTGCCACCGATATTCCCCGAGTCGGCCTCCACGCGCTTGACCGGCAGCTTGAGTCTCGAGACCAAGATCTGGTTGTACGCCGCAGTGACGTCC
TGGTACGTCTGCAACGCACCGTCGTACGAGGCGTCAAAGGAGTACATGTCCTTCATCACAAACTCTCTCGCTCTCAACAGACCAAATCTCGGTCGAATTT
CGTCGCGAAACTTGCGGCCGATCTGGTACAGTCGGAGCGACGCGTCTACAGCGCCCGCAGCTGAGTAATGCGCTGCCACGAGGCTCGTGACGCTCTCCTC
GTGAGTGGGTCCGAGCACCAACACGTCTTCTCGGCGGTCCTCGAGCGCCATGAGCTCCGGGCCGCGGCTCTGCCAGCGCCCCGACTGCTTCCATAGCTCG
TGAGGCGTTAGCACAGCCAGGTCCACGCGGTTGCCACCAATTTTGTGCATCTCGTCATCGATGAGCGCCTCCAGTTTGGCTACAACAAGGCGGCCGAGCG
GCAGCAGCGCGAAGAGGCCGTGGCCGCTTTTGCGCACGAAGCCGCCGCGCACCAGCAGCTGGTGGCTGGGAACCGCTGCGTCTGACGGCGCCTCCTTCTC
CGTGGGCGCCCACAACACAGAACGCAAGGCGCAGGGGGCGGCGCGTACCGCCTGGGACGACGACAGGCGCCGCTCGGCCGTCGCCAAGGACCTACGGCGA
GCAGCCCACATGAGCAGCGATTTGAGCCGCAAAAAAGGCAAGTATCTCTGGTGTGTGGCGTACACCACATTATTTTACGACATGGCTTCGTTTTTCTCTG
CAATGGACTCCCTTCAACAAGTAAAAAATTGGCATGGGATACTGTCGGAAGCCCCGCAAGATGATGAAGGAAGCAAATTTACCCCTGGACAGCGGAGTCG
GTCGAGTTCGTCTTGTTCGCTGCAAATGCTGGGCTGACTCATCAGCTGGGGAGAATAGTTGTTGCTGGTACAGTCGAGCGCCGGAACCTGTCCGACTTGG
CCAACCCCGCAGTCGCCTATTCGTGTTCCGTCACTTGTCGTCGCCACGTCCGTTTGCACGCAGTGTCGGGCTCTCGTCATGTGCGGCGTCGACACTCGCA
CGGTTTCAGGGCGTTATTGCCAACAAGTCCATTGCCGAGGACAGGTTGCACTCAGGATAGGTACACTTGCCCCACAGCAACAGCTCCAACTCGCACGCAA
CGCATCCAAAGTCCAACGCAAGAGAAAAAGTGTAGGCTGGATATTGTGGTCCGTAATATCATGTGCATCTCCGCATACACCGCCACATCCGACCCCGTCT
CCGTCCCATAATACCCTATGCCAATTAAACCGGCTGGCGACCTTGACGTTGTCCGAAAAATACAAGCAGGTGCCAAGTCCCAGTTTAGTTTCTGCCGCCT
CGATCGATGGCTTCAGCTTGGCGCCAGCATCCGCACGATCCGTGGGACCTGCCGTCGCCGCCGCCGCTACTAGAAGAAGCCGCGCCCAAAGCTTCCAAGC
GCTCACACTTTTCACGCCGCAGCACGCGCGCCCAGAGCCAAGCGAGAGCCCAAGCGCAGCAGGCGGAGCTCGAGGTGGAGGCGCTCGCCGACCAGCGCGA
CCGCGACGAGCGCCGCAGCCTCCTGGCCGCCATGTTCGGTGGTCGCAGCAAGTCACGCACGTCGCGATCGTCCTCGGACGCCCCGCAGACGCTCGTGCAG
CGAGAAAAGGCCTTCCGCCTCGTGCGCCACGGCTCGGACCCGCTGCTGAACGACGCGTTCTACGCCACGCAGGTGCAGGTAGGCAACTTCGTCAAGATGG
GCTGGCTCACCAAGCAGGGCCACATGTGGAAGAGCTGGAAGACGCGCTTTTTTGTGCTCTTCTCGGACGGAACGTTCGCCTACTACAAGAACAAGGGCCG
CAAGAAAATCAAGGGCTGCATGCAGCTCAATGACGGCGTCGTGTCCGTGCAACACGTGGACGTCCGCGTGGCGGACAAGGCCTACGTATTCCAGATAGAG
AAGGGGTTTTACAAGCTGCTGTGTTATTGCTGCAGCCAGTTTGAGGCCGAGCTGTGGGTCGCAGCGCTGCGCTCGGTGCGGAGAGTGACCCCGCCCTGTT
ACGAGACGGATCTAACGGCCACTGAGGAGAAGGCGGGCTCCAACGCGGTCACGAGACACTTGAACAAGATTTTCATCACAGATAAGCAGATCGCCAAGAG
TTTGGTGCAGTTCAAGGTGAACGAGCACGACCATTCGTACGCAGCAATTCACAATTTTATTGTCGAGCTGGACGACGCGATCATTGATGGTCATCATTTG
GAGCTCTATCAGGACCCAGAGATTGAGCTGCTGCCTGGTAATGACCTGGTACGGCTGATTCGTCGACATGTGGAAGATCGAGTGTTTATTCCGTTGTATG
CGGAGGCGTACGCGAGCTTGGAGACGGACAAGGTCAAGACGAGGCGCAGCAACCTCGAGCAGAACCTCAAGGTGCTGAGGCGGAAAACTCAGGCAGATTT
TGGCATCTCGAAGGATTTATCCGTTTGCGACTGGAAGCTAGCCATCAATGTGATTAACATGCTCGAATGCGTGTCGCTCCCAACGCACAAGTTCGAGGTC
ATTTTATCAGCTGGAAAGGCCATCACGGAGTCTATTGCTCAATATAACGGCGACCTGTTCGAGGTATCAGATGAGACGCTGACGGCGGTTTTTCGGTACG
TAGTTACAATGGCGTCACTGAGCGATTTACCGATTCTGCGAGCGCTTCTCAAGTACGGATACCAGCACCACCCAGCGTGTCAGAACAAAGCAAACGTCGT
TTCAGCTTTCCTCGATGGGATCAAATGGGTGGAGTGCTTCGAGACTGGCGATGAAAGCTATCAGTTTGATTCCTTAGCGCTAGCAGGGTCTCGCGTGTCG
GTATCCATCTCGACTAACGATGTCGGCATTCAGTTTACGACCGATGGCAATGGTAGAGGGGCTATTGTTTACAGTGTGCGAAAGCAATCACAAGCAGCAC
TTAGCGCTTCAATCGTCCCTGGATTGTCGCTGATTGCCATCAACCACGAACCAGTTATCGGGATGCCTTTCGACAAGATTATCCAGCGCGTGCGAACTGC
GGCACTCCCTAAGCAACTCATTTTCATGACCGAGTTTTACTACTACCAGCTTCTTTCGCTGGATTCGGAGATGTTTCGATACCTAATGTGTATTGCAGCG
CGCCGTGGGGACTTGGATTCGGCTGCTTGGCTGCGGTCGTCCACGGTGGAGCTCAATAAACTTTGCTCGTGGGAAAAATCTCGAGGAAAACAGGTCTTTG
GATTCATCCCTGTATCTGGGAAGGGATCCCCACTTCACGCGGCAGTGCATAACGGTCAACTCTCTATGGTGAAGTATCTTATCTCAAGAGGGGCTGATAC
GAACTTGTGCAATCAGAAAGGAAGACGCCCACTTCATGTCGTGAAGCAGTCGATTGATATGGCGTTGATCATTGAGAGCCTTATTGATGCGGGAGCTGAC
ATTGACGTAGCGGAAAAACACGGTCTTACCCCGCTAATGTTCATGTGCTTTAGAGCATCGCTTGAAGGTGCCGCGACGCTTGTAGCACTTGGAGCAGATG
TTCGCCGTGTTGCATGGTCGAATGGATTTTCGGCTCTGGAGTTTGCAGTGAAGAGTGAACGAACAGAGCTGGTAGAGTTGTGCCTTTCAAAGGGGGCAAA
TCCAAATATGCCTACGCTGGACGGAAACACAAGTTTGCATATGGCAGCCGCTCTCCCCCACGCTGATATAATCCTCCGGCTCCTACAGAGCGGTGCAAAC
CCCAATGTTCAGAATCGGTATGGTCAGACTCCGGCCACAGTCCTACTTGCGTCTGCTCCTGGTGGAGGTGGCGATGCCCGAATCCTGTGTCTGGAGATTT
TAACATGTGCCGGTTGCCGGTTGGACAAACGTGATCTCTTTGGTCGCCAGGCTTCTCACCTGGCAAACATCTCGCGAGATTCTCATGTCATGGGTCTACT
TCGAAAGTTGGGATCGTTGAACCGAGCAGGCAATAGCGTTGATGTCGATATCTTCGGTTGCTCACCTGTTGATTATAGTCATGGGATCGAGGTAAGCAAG
GCGACAGAATATTTTGGATCGCAAATGCCGAACAATTCGTGGGAAATCATTGACAAGACCGACCACGTGTCTCGATCTGCACTCTCGGGTTCTGTCGAGG
ATTTGATTCGCAAGTTAGTTGCAGGCACGGAAGTGGACTTGGTGGATGTGGTGGCGTTCGTGCTCTTCTTGGACAGCTTCTCGAGTCTTAACGAATTGGT
GGATCGGTTGAGCGAGCATGTCCGAAACGGGATTAAAAGTAAGTTTTGTGCGTGCTTGTTTGTTAATCCTTCGCGCGGTCAATATGCACCTACATTAGAC
ACTAACGTGGCATTTACCCATTTGTATTGTTCGTATAGGCCACGGACTTATCCGTCTCTTCATCATGATCCTGCTTTTTAGAAATACGGAAACGAAGGAA
GTAGATGATCTGTCTGATCGCTTCTACAGCCTGATCAGTCACAACATTGACGTCCCTAGGGAAAAGTTGGTACCTCTTGTTGATGAGTATACCTCCCTTT
ATAGGGAATATTTCTCATTGCGAGGAGCTGGAAACTACGCCACAACTTACGAAAGGATTCCAGAAATGATGACTAAGATATACGGCTTGGAGTCAGGCAT
TGAGTTCGTATCCGACGAGCCCTTTCCGCTTCATTTGCACCGGTAAGTCGAGTGATAGCTCATTGTCTCCCTTTTGATCGAACATATCTGACCTATGGAT
TTCGGTCCTCTTTCGTTGGGTAATATCTCAGGTATATTGATGCAGAACGGTGGGCTGAACAGTGCACGCTTCTGACGCACGCAGTCTTTTGCCAGATTCC
AGGTGGGATGTTATCGTCTGCTTGTTTAGTTGGAGGGTTGACTAAACTTTGCTGTCTCTAAAATGCAGTCCAAGATTTGATTTTGACAGGCTCGAAAAAG
CAGCACTCCGTTGAATTTACGAGTATCAAACGATGGTTTCAGCACGTACGTTCTGTTGTCGCTTTATATTTACGTGCTAAAGAGATTAACTTTCGGGCGT
TTTTGTCCGTGGTAATATTGTGTAGATCTCTGCGTACGTGATCAACGCTGTTCTTGTACAAAACTCCCCAGAAGAGCGTGCCGAAGTAATTTCGTTTTAT
CTCAAGGTAAAAGGATATTTCGGCTCGTTTGACCTCTGGTGGGCTGCATGCTAACCTTTGATTTCGAACTATGATCAGGCCGCCGATTATTGCGTGTCAT
TACACAATCATGATACGCTGGCTTCGATCTTATACGCATTGCAATCTACTGCGGTACAACGGCTTAGAAAGTCGATCGATTGTGTACGTTATTACCAGCT
ATGTTCCTCTCGTGGGCACGAAGTCACGAATTCTGATTTGGTGGTGCATTACAGCTAAGTGCGGAAGCGAAGAAGATGATGAACGAAATGCAGCTACTTT
CCGACAAAGGATGTCGCGAGATGAACCGGTTGATGCGCAAAACTGTCAACCCCAGTATGCCTTATATTGGGTTGTATCTCCAGGTAAAGACGCGCATTTC
AAAGTGATGCCTTCGGACGAAAATGTCTGACATTGTGCGTGTTGATTTAGGGCTTCGTCGGACTGAACGAGTTGCCTGCGTTTGGCAAAGAGGGTCAAGT
CAATGCGAGTCGGCTACGAAAAATGGGCGAGTTGGCAATGGAAATCTTGCACCGCCAGTCTGTTGCGTACACTCTTCAAAACGACGAGAGTATTGATGTG
AGTAGCAATTTTGCCTGTCGTCGTAATCCTCAGCTGTGGATATCACGTCTAACCTGCGTATGTAACTCTTTTGCAGAAACTGTTGCACGTTTCAATGCCG
TATTCGTCGGAGGAGAGTCGATATGCTCGGTCATTGGAGGTCGAGCCGCGTGAAGCAGATGCGATTCCATTGAGCGATCGCGGTTCGTGTGTTGTTGTTG
ATGACGACCTCGACCTTGAAAATGAAGTTCGCGAGTCAGTTGGCGGCGATGGAACCTTTGGATTCCGCCAGTGGATTAGGAAGCAGCAAGTCGTGCACCG
CAATCGCTCACGCTCTTCGCTGATAGCTTTGTACGAGTGGGTGTAGCTGTGATGTGCTGTCTTCTGCGCCGTGCTTTGGTGAATACTTTTATCTATTCGT
TGTGGAATGTTTTCGCCCAACATTAATACATTAGCATATTTAGTTATCAGCGATGTACTTCTCGAAGTCTTCCATCGACATCATGGCGTCCGGATCCAGC
GATAGTTCAGCGGGGTCCTTTTATCAGCAAATGGCGCTCATTAAGTTAACCACTTGTGCGCAGTTGTCATCCACATGACCAACGTACCTGCTTGTCCTTG
TCCTGCTTGTGCTCGTCAGCACCGAAAAGATCGTTTTGCGACTTTAACACTGGTGACGGCGGATCATCCGTCGTCAGGTCTTCCATCTGCTGCATGATTT
GATCTCCCTTTTCCCCAAGCATGTAGTCATCTCTTCAGACGCGAACATCACCATGTTAGTGCCGCTGTTCAATGTCGCTTCTTGTATGCCTCGACGTACA
GGAGGCGATTCAGCTGGATATCGCTGGCTGCAGGAACGGTACCATCCGACTCGGGTTGAGACTTCTAATAGTACGACAATCTCCACAAACTAAGGCCAAA
GTACCAATGCTCGTCAATTGTAGCTAATATTGCTGCCCACCTCCGTCTTGGAGAAGAGGTCGTGTGGCTCTCGGCGCATCTGCGGACGCTTCGTCTTGCT
GTCCTTTGTAATATTCTGCCAGTGGTGGATCTTGGTCACAATGTCTCTGACGACACATTCTCCGTCAATGCAATTAGCACTTGCGAGAGTGATAAACTGC
GTCGCCTACTCGTCTTCCTCTTCGTCGGCGAAGAATCCACCTCCGTTGTGGGAATTCGCTTGGTCCCCACAGCGCGCCACCTTCTTTGATTCGTTCGCAG
GGGCAACGTAGCCATCCGTATGCGCCGCATCAAAAAAGGAAAATGCTACGATGAAGGCACGTAAATTCACAATAAAATAGTTTGGTCATCTTGTCAGTGC
AAGCATTTCGACGCCCTTACTAAATCTCGTCTTGTGCTCCGCCATCTTCGTGGTCAAAGCTTCTGGAAAAGATCCAATTGTAGAGTGGTACACGGTACCG
GTGTTGAAGCTTGAGCACGGTAACTTCGAACTTACTTGCGCGCCGAGCACTGCCCATGGAGGTCTATCCACTGGGTAGACCTCTATATAGCCAAGTAGAC
TTTACTGTCATGCAGAAGTACGCTAAAGTGTAGCGGCTAAACTAATGAGAGCTAGCGTTGGTGAGCGATTTGGATGCTCGTGGAAGGGTTGGAACAAAAT
GTCGGCTGGATTACAACGTGTACAATAGATTACAGGCCGCGCACATCCAACACGCCTCTCTTGAATCGCCCCTTGGTAGCCTGCACGCCATAGTCGACCT
TCTTTCGCTTTTGGTGGTCTCTCGAGTCGCCGCTCGATTTCCGCTTCCCTGTCACCACGTCCGACTCCTTCAACTGAGTGGTCGTACAGCGAAAGCAACA
GCAATAGTAGCAAGAGTGAACATGCTACAACCGACAACAATCACAAAACACCTCAACCACAAGGCGTACCAGCTCCTCGCGACGTTGCTTGCGAGCCACG
CCCTTCGTCTTCAATCCGATAAGCACCTTGTAGGGCACGCTGCGGTTCTTCGCCGCTTTGCCACCCAATGCCTCGATTTTCTTGGCCTCGTGCGCCTTCT
TCTCTTTTCCCTTTAAGCTTGAGCTGGCTGCCACCGTCAACGCCAGGCACCAAAATCGAAATTCCGTAAGTGGCTCTAATCCCATTGTTCTAAGCTCTGA
AAGCTGCAAGACAGTAACGCACCGAACTCCAGCACCAAGTCGAACGTGTCATCGAACTCCTTGCGGATCTCCTGGCGCAATGACAACTCAGGTTCCTCTT
CTTTGGCTTTGCTCTGCGGCAAAGGAGAGTGTCAAAGTCGAATCCATATCGAAACAACCGATTCAAGCACGAACCTTGTTCACGCGGGGCTTGCGCTCCT
TCCACGTCTCGGTGGGGCACTCGAACACCTGCACTTTCTTCTTCTTACCGCTCGCCACGGGGAACTGGAACGCCATCTTCGACTCTGGTGATGGTCGACG
CCAACCAAATGCTAGCGCTAAACTAACTGCTATAAATGTGGACCACATAAACATCAAACCCGTGACGCGCGCAACAGATCGATACTATTTTGCTCGAGAA
ATGCACTATTGTTACTACAGGTTCGTCGCTACAGTTCAGACCAGAACTTGCACCTGGAACAGACCACTGCTGGCTGCTACACGCTCGTCGCCGTTATGAC
TGTCCAGCTCGTCCAACTCGTCTTCAGCGTCACTTTCACCTCCTTCGCCGTAGAAGCTGCTTCCGAGGTCCGAGCCAAAACTGTCCCGTCCGCTGACCGA
TTCACTCGCGAACGAATCCACCTTGTTATCGCTCTTTGTTTCCTGCTCAAAGTCATAGAAGCCGCGGCTTTTGATGACGCGGCTGCTTCGTAGAGGATTC
GCACGGCGGTTGTCGTTATCACCACGTCTGTCCGCTGCGGTCGGAGAGGCAGTAGCGCGCGGTGCTGGTCCGTTATTGTTTTGATTTTGCGACTTAGGGC
TCAAGGGAACGAAGACGCTTTCACCAACCAAAGACTGGTTTAGCACACTTTCGTCGCACGCTGGGACTGCAGGAATCGGCCGATATCGGGACAATCGCTG
AAAGCGAGGAGACTCCATAGCATTGACTGTCATACGTTTGTCCGGTGTTGGCGCTGAAAAGTCGGCCATGGACATCGGACTTGGTGGCTTTCTTCGTCGC
CCTTGCACTGCGGGGTGAGCTTGGTCGTCCTGAATATTCAATTCTCCTAGGGTCTCGCGAAGCTGATTCAACCGTGAGAACGTCTGCGCTTCGGGAACAT
CGGCTGACCGATCCGGAAGTGCAATACCACCACGCGCAATATTCGATTCAAATCCGACAGACTGAACTGGTGCCAGTCGATGCTGATACGAAACAGCCTG
GTACTGATCCTGTTGCTGAGCTTGCTGCAGGGTTTGTCGAGCCTGCTGGGTCTGGAGGTCCGTGTGGTGTTGCTCGTTAAGGGCTCGTTGTGCATCAACA
AGACTAGCCATTTTCTCGTTCTCAAGTTGCAGCAACGCCCGTTGCACACGCAGTTCTTCTTTCTCGCGTCGAACCTCATCCCGTTCTCTCCGCAGCTCCT
CTCGTTCACGGCGAATTTCTACCAGCAGCGAGCGGTACTCATCAATCATACGGCTCTGCTGCTCCAGTTGCTGGCGTGACTCCTGAGCGTCGTTCTCTTG
AGGATATAAATGTCTCCCTACTATGCCATTGGCCGGGCTCCGATCAAAGGTGTCGCGTCCGCCATCATTCGCACTACTCCGCTCGATACCTAGTTGCATC
TGAATCCGCGAAGGAGCAGGAGGAGGCAGCAGTGTTTCTGCAGGGCCCGTGCTCCCATAATGACGGTCTCTCTGATAATATACCGCCTTGTCTTCTTCCC
GTGGGTCTCTGTCGAATGCAAAATTGTGACGACTGCTTGCAGTCGGTTGAAAGTCGTTCCTCTGTCGATCCGTCAGATCTGGCGGTGGCGGCAACGTATG
AGGGTACGGAGAGTTCATCTCTGCCCTATTGTCGTTCAGCTCAGCATTCACCGCCGGTGAGAAATGCCCCAGTTTCCGCTGCGCTCGCAGCTGCTGCTCT
CGGAGGAAGCGCATCTCTTCCCTCGCCGCATCCTCCTCGCCGCGTCGCCGCTCCTCCTGCTGCAACTCCTTCAGCCGCGCCTTCTCCTGCACCTGTTCAT
CCAGCATCCTCTTCCACTGCATCTGCTGTGCGCGTTCTCGCAGCCTCTGACTGGTCTCGCTCTCGTCTGTCACTCGGAAGCGCGGGTGGGACGACGAAAC
GCTGTTGGCTTCCCCCGTCGCGGCGCCGCGGTCTTGTCGTTGCTCGTCGTGCAGTTCCACGCTCTGCGCGAACTTCCAGGGCGACTGGGAGGCCGCTGGC
AGCTCGAAATGGCCGCCTTCGACCAGCCACTTGGCCGGCGAACGCTCGCTCGGCGCCAGCTTGCGCTCCAGCTCCTCGCGCTCCATCTGCTCCTGGTGCT
GGCGTGCGCGACGCAGCGCGATCTGGTGGTCCAGCTCCCGCGCGTAGGCCTCTCTTCGGCGCTGGATCTCGCGCGGGTCCTCGTCGTTGGCGCCCGAGTC
CGCAGACCACATGAGGGCTCAGATTCCTCCGGCAGAAATTGTCGAACGTTTTGATTTGAAGCAGTTTTTGAGAGGGAAGGCGTTTGATTGGAGGATAATA
GAAATTTGGACTGGTACAGCAACCTGACCAGGAACGGACCTTCCTAGAAGTTCAACGAGTTGCCAAACAGACACGAGTCGGCGTACTCGCGTCGCAGATC
GACCATTAGCTTTTCCACTTGCAAGTCGCTGCGTTGACACTCAGATTGCAGCAGTTGGAAGCGAAGTGACACGTCACTCTGGAAGCGACGCAGCCTCTTG
CGCTCCTTCTTGGCCCCATCTCGTCGAGGTCGGCGGTGGTGACTGCCGCTCCGACGTCGGTGCTGTTTGTGGCTGCTGCAGTCGCTTTCGCTGCTGCTGC
CGCCCACGTCGCTGTCATAGTCCTCACTCTCAGCTTGAGGCCCGCGCAGCATCTTCTGGATACGGACGCGCTCTTTTCTGCGGCGTTCGCACTGGTCCAG
ATTGCGTAGCAGCGCATCATGTTCTCGCTGCAAGCTGTCGAGTCGGTCCTGGCCGCGCTGGAACGTCTGCTCTTCTCTGCTGAGCCACTGCTTCTTGCGC
TCCACCTCCCCATACAGTTCCGTCAGTATCTCGTGGACTTCCGCGTCGTCGGTGCCACGCGTGTTTTCGCTCTGCGTCAAGTACAGCGTCTTGTGCTGGG
AACTGCCATTGCTTGTCCCTCGACCGCTCGATATTTGCTCCTGTGTGCGCACTCGGAACACGACAGATTTCTCTGTGGTGCGCACGACACTACGGCGGGA
ACATCGCTGGCTACTTTGCGTGGGAGACCAAGCGGGGGAAGCACTGCGGCCCCGGGAGTGAGTGCTGGACGACGAGCTCGCGGTGCCGCTCATTGATCGT
TGCGGTCCAAGATTTGAGTGACGAAGTGAAAATCTCTGTTGAAACCCTTGAACAATTAATAATTTCGCTAAGTGAACAATTAGTGAATTTGTATCGGGAA
CAAATTCTCAAATCAGGTAGCCTTCTGAAAACAGATATGAAGCAATGTATCGACTTTGTCAAAATTGCAGCTTTTTGCTGTGCATCGAATTGATTGTCTA
GCTGTTGCAAGGCCGTTCCTGTCTAAGCTTCTTGTGCTGCGAGTAGCGATCTTTGCTGGTCACTGCATAGTCCTCGATGAAGCAACACATTTATAGTTCG
CTGTGAGGGACGGGTTTGCTGGTGGGGATCGGCGAGATCATGGGCGAAAAGATGGGGCGAGAAGTGTGCATCAGCGCCGTCGAGTGCGCCCCGCCTGCGG
AGACCTGGCGGACAGGGATCGGACCAAGGTCTAGACGCGTAGGCACGGCGAGCGGCTTCATATCCGTCAAACCCAGTCGTCCGTGGCTGCAAGAGTCAAG
AAAAACAGGGCGAGATTAGCGTTTCCTCCTTGTCAAGCCAACTCGGCTGAACAACGTACTCGGGTCGTCCCGCGACGTAGGCAATGCCGTCGCTCGTGAC
GAACAGAGTGTGAGAGCCACCACATGCAGCTTGAATCACCGTTTTGCCCTTCAACACCTTCACCTGTTGAGGTAGAAACATCGAGACGTCAGCAATGATT
GCAATACTCAAGCAACCAGCGCTCCGTACCAAGTGAGGTCGCGTTCGACTCTTTGTGTCGCCAAGACCGAGTCGGCCATACTCGCCACGCCCGAAAGCAT
AGCAGTCTCCCGACTTGGCCACCACCGTAGTGTGCCAACCACCACATGACACACGCCTGTACAGTCCCGAAGAACACAACAATCGTTAGCATATTAAAAT
CCGCACATAGGTAAGCGACAAGACAAGCAGCTTACAGTGCCGGAATGGCATCGAAAAACTCGACTCGCTTGGGCGTCTGCTGATCGGACGTCTGGCCAAC
GCCGAGCATCCCGTAGTCCTCTTTTCCCCAAATGTACACGTGCCCTTCCTCGGTCACAGCAGCCGAGTGGAAAGCACCGCAAGCGACTTGCACGACCTTC
TCGCCGTTAAAACCTTCAAGCAATCGTGGTCGACTGACTCCCAGAAGCCCCTCGTCCTCCGTGTCCTTCAGCCACGCAGCCCCGATGCCCAGTTGGCCGC
TATCACCTCGACCCCAGACGTAGACGCGCCCCAAGCTGGTCAACGCAGCCGTGTGCGTCCCGCCGCAGCTGATTTTTAGGATCTTTTCGTTTGCATTGCC
TTCCGGCATCGGGCACTTGACCGGCAGCGACTCGTGCGCCGCCTCGAACTCCTTGGGCAGACCCAACTGTCCCCAATGCGACTCGCCCCACATGTACAGC
GTCCCGTCATTGGTCACAGCAGCAGAGTGGCAGCCTCCACACGAGATATAATCCACCACGAGTCCATCCAGCTCAAAGAAAGCGATCTTCTGCGGCTCAT
TAATACTCTTGAGGTCTCCGTGGCCCAGTTGACCCATCTGCACAAAGCACAAAGCGCATCCAGTGAGTACGTCGAGCAATGCGCGCAAGAGGTGGCGGGG
AGCGCACCGATCCCCATCCCCACGAATACACAGTGCCGGCAGCCGTGAGCGCCATCGTGTGGCGGGAGCCGCAAGAGACCGCGATGATCTCCTCGCCCGC
CAGACCGTCAAGCTGGTTGGGGAAGTTGGAGGCCGACACGTCGTCGAGCGCCAGCGTCGGTCGGCGCTTGGCACCCGTGCCCAGCTGCCCGTCGTCGTTA
CAGCCGAACGCTATCACCGCGCATTGCGTGGCGCCCGTCGAGATGCTCATCGTCTTGATGCTGGTTGGCAGTCTTGTTGAATGCAAAATTGAATGCAAAT
GCCAGCGAAAACCTGTTCAGATCGATTTGTATTGTTGTATTTGTTTGTATAAGTCGTATTTGTACCTAAAGATGAATACATAACACAAAACGTACATGTA
ACTTCAACATTGACGATCGTCCACGGGGACCTGTGTGGACGCTTCCGTTATAGGAGCGTACATCTGCGCCTTGAGAATGTGGACTCGAGGGCCGCGAAGT
CGACCGCGCTTGCCCTCGAGCTGGCGCTTGATCTGCGCGAAGCGAATAGCGTTCGGGTTCCGAGGCGGCATGGTACCGCTCCACGCCTTGGACTCGCCAG
TACTTCTATCGTTGCTACTGCTACTTTTGAGTGAGTGCTGGATATGCGAGTGAGTTTCCGGTCCCAAGGCGCCTTCGTCGTCCTCGTCGATAGAGTTGAT
TCCGTATTTCTTGGCTGTGTTGGTGAGCGACGGCACGAGCATGCGCGTGGTGCGGTTGATCTGGAATTGCTGCTTGTACTTAGCCATCAGGCGTTGACGG
AAGGCTAAGGCCTTCGCCTGTTGCTCACGCGCCGCCATTTCTCGGCGGTAAGCTTCACGTTGAGTCGGGTACTTGGTGCTCACCTGCAACGCTCGACAAC
GACGGCGACTTGCATCGCCACGCACTAACCGTTGAATCTTCACAGCTGGAGACTGCCGAATACTTTTCAACCATCCTTTCTGCCGCTTGTACTCGCGAAA
TACCACGCGCGTGGTTAGTCCTCGCCAGTGCGCCTGGATACGGCTGACCAGGGCATGCTCGCGACGCAGAACGCGCCTCGTGATTTCCAGCACGTTGTTC
TCCACCTTTATCAGTGTCGGCCTGCCACCTGATCGACGCACATATTCTCTGTAGTTCCAGTAAAAGACGCTAAGCTCTGCTGTGTTCGTGTACCAGAAGA
CCGGTGGCTCGTTGGGTCGACTCGCTAAAGCGTAACTAAGTATCTGCGGTGCCATGAAGCTGATTATCCGTAGACACCGCTCGATCACCGTTCGTCTCCG
CGCCTGCATCCCCCGTACCCGGGTTTGAATCCTTGTGGCCGCTCGATTGATCTTCCGCAGATATCGATCACGCGCTACCAGGCGACGACGGAATTCCAGG
CGTCCCAGAAATCCCCTCGCGATACGCTGGAGCAGTGCAGTTGCCGGGACACGTCGACGTTCGAACTCCTTGATGGCATTTCGCTCTTCCTCGATCTGTT
CCTGGAAGCTCACGACCCCTGCGCGTAGATACCGAGTGCTGCCACACCCTGGGCATTTCGGTACTTCTTCATACAGAAACGTCGTGTCTTCTCTTTCGCC
CAACTGGTCTGCCTTGCGCCGTACTCGCAGCACGTCGATGAACGTCACGCTATTGCATCGTTGGCAGGTCAGGTACGGTGTCATGGTACTGAGCAAGTCG
TCATGGCTGAGCTCCGGCTTTTGGTCGAGAGCATTTTCGACGTTATCAGGAGTCGTGTCGACAGTCGAAGCTGCGTTTGGTGAAGGGATCTCGGCATTAG
TCTGAGCGATTGAGTCGCTGCTCGCTGTTGGATGTGGGTTGCCTGGTTGTGAAGAGTTGGGCATGGTCCTCGAGCTGCCAGCGAGCCATGGAGTCGGGTC
ACACTTGTGCACCCCTTCGCTAACCGATTTTCACGACTGGATACCAGTGGGTGCAACTGAAAATACTAAGCAAGAGTGGTTCGTGTTTCATGTGCTAAAC
GCAAGTTGTGCAGCCATCCAACCTCATTCGTCGTCGGCGATGTCTTCTTCCATTTCGTCCTCAATCTCATCGTCTCCAGGACGCCCCATCTTGTCGTCGC
GCGAGTTTGGACGACTCATTTGCGCCTCACGAGAACCTGGGCGACTACTGGGAGCCTCACGCGAGGCAGGACGCGATTCTGGGCGACTGGATTTGGCATC
ACGCGAACCGGGTCGGTTGGACGAAGCAGACTGCTTATAGTCACTGGGCGAGGGTCTGCGGCGTCGGTCGTCACCCAGAGAAACGCCTAACTTCGCTTGC
ACGGACTCCACCACCCGTGGGTCGACGTAAGTCTTGATTGTGAGCCCCTTACGGTTCATCTCCTCCATCGTCTCAAAGCTCTTGTTCAGCTCGCCTTCTT
CGTAGTACGCTTCTGTTAGCATTGCATATGCGTCGCCCACACGGATAGCCTCCTCAATACCTGGTTCCTCCAGCAGTTTGGTGACAATGTCCATCATCTC
TTTCGGGTTGTGCTTCACTTGCTGTCGGGCGACGACGAATTGCTCGATCAGCAGAATGCGCTTCTCATAACGCTTCAGCAGTGCTTCCTTGCCGTCTGCG
CGAGATTTGGACACCACCTGAACGGCTTCTTGCAACGCAGAAATTGCCTTCTCGTAGTCGCGATATTCCTCGATTTCCACCTGAGCACAACCGGCATAGA
AGGCTGCAAGCTGCTCGAATGCACGTGCTTTAGTGTAGAACCCCATGATATTCTTCAGGATTTCCGGGTCCTTGCGCCAATCCAAATTCTGCAAGTAGTT
CGCAGCCAGAACGAAGATTTGGGCGTTGCGCGATACGTTAGCAAAGAACACGACCTTCTCAGTGTCGCCGGACTTGAGCAGACATTTCATGGCCTTAAGC
TTGTTGCCGGCTTGAGTGTACTTCTTCGTGGCCAAGTGATACGAGCCTTGCTGCTTGCAGCACTTGGCAAGCTTAAGCAGTAGCTCAGTGCGCTTCTTCT
TGTCAGCCGGCGACGCGGTGTCATCACCTTTGGGAGGCGTCATCTTCTCCGCCATCTCTTCAGTAACCTTCACATCGTGTTGCATGCACACATCCAGAGC
CTCTGCAACGCGATGTCCGATCAAGCACAAGTGCACGGCCTTAGCGAAATGACCGTTGGCGATGAAGAAGTCAGCGCATTTTTTCAAGATAGCGGGCGAA
GTGTTGCCAGAGCCACTGAGTTCGTCCGTGAGGTGATGCAGCTCCTCAAAGAGTTGGGCCTGGAAACACAAATCGAGGGCCCTAGCCACGTTTCCTCCTT
TGTGGTACAGCTGGACGGCTTTCTCCATTTCATGTTGCTCTTCGAAGTATGCAGCACAATCAAGCATATCACTGGGCTTGCTCATGAGCGCGAAGCCCAT
GAGGTCGGCGTCCATGCGGTGCTCCTTGGCCAGACGAATGGCATGGTTGTAGCAACCACCGCTTGCGAAGAAATGGATAGCGTTGGAAATTTCGTTGTGC
GCCTCGAATTGCCGGGCCAGATGATACGCTGCTGCGCGATTCCCGCTCGTCTGTGCTACTTTCGCAGCCGTCTGGAAGTCTTTCTTGAAACACAAGACGC
GTACAATGGACAGGTAGTCCTTGGCACGCTGATAGCTTTCTACGGCAGCATCAAATTGTCCCTGGCTCTCTTGGAACTGAGCCCACCAAATTAGCAGGTC
GCGGTTGTTTGAAGTTGCTACGTACTTCTGGAGTATGTCCACCTTGCCCAGCTTGAATAGCATGCGAGGAATATCCTTTTGATGAGTGCCAGCATCCTCG
TAGGCTTCCATCGCCTCCTTCAGATCTCCCATTTCCTCGTAGTGTCGTGCCAGTGCGTGGTAAGTTGTCTTGAGATGAATGCGGTCGCGCTTGGCCGCTA
CATCAACAGCCTTTTTCCAGTATCCGCTGGCCTGATAGAGTTTGTTCAGGAGGTCGTAGCGGCCGCACTCGCGGTACAAACGGGCTGCATCGTCGCGAAG
GCCTAGTTGAATTGCTACCATGGCAATCGCAACTTCGAGCTCAGGTTCTCTCTTTGCCTCTTGCACTGCAGCCGCACCTCGAGCATGGCCCATATTCCCG
AGACATACCTCAGCCACATCCAGCCGCTTCGTCTTCACGCACATGCGCGCCATGTTCTCCCAGACGGACGGATTTTCAATGAGTTTGACTGAGCGGTACG
CTTCATCCATATTACCGACCGTCATGAAGTAGCAAAAGTCGATTAGAGCTTGCTTCGCCTCATTGTTGACCTTATCCAGCCCCGTGAAGTCGCGCATGAT
CTGTGTGCGAAGATAGCTAATGGTGTCGTAAACCATGGGAGTTTTAGTGACGGGGTTGTTAGCCTTGGTCCGGCCAACATGCACTACGGTTGTGGAGTCA
TCTGATGAGCTGTTGTCCACCTTTGCCACGAAATATACACGTGGAACTTGAATACCTAGTAGCGCGGAGTACTTCAGATCAAGGTCAAAACTGTCTTGCA
TCAGTAGGCCGTGCTCGTTTGACGCAAAAATGATGGTGACCTCCTTGTCTGAGACTTGGTTCCCGCGCGCACCACCGGGACCACCAGTCCCCAAGCCGTC
GTCGGTACGACCAGCAGCAGCTCCACCCGATGTCGTCGACGCACTATCATTACCTGTCTTGACAGTCTCGCAGATAAGCAACCGTGGCTCTTGAGGATCG
AAGAAAGCTGAGGTCGGGTAGCGTGAAGAGCCAAAGTCAAACTGCTGGTAAATGTTGAGATCCGTTTGAAACAGGAAAAGCTTGTTCAATGGTTCTCGCA
TTAGCAAAGCACCTTCAACGCGGTCAGCAAGAATGCAGATGCGAGTGCCGTCCGAGTTGACACAGATTGCTCGCATCACAGCAGACTTGGTCTCTTCTCC
AAAAGCTTCGGGGAGATTTCCCATGCTTCCTAAAGCTTTGGGGTCACGGCGGGATACGTCGAATACGCGCAATAGGCCCCGATCCGTACCCACAGCAAGA
AACTTGTTCTGAAGTGACAGCATCGCCGGCCGGCCTTCGGCTTCCGTGAACGAAATGGTGTTTTTCACTACTCCTGCAAGGTTACAAACCTCGACATGAT
TTCCGTTTGCCCGATAAATGGATTCACCGCGAAGCACCATAGCACTCGAAAAACACTTGAACTGATTAGTGACTTTGGCATCTCCATCTTTCATTTCGTA
CACTTCTGCTTTTGATCCGTTCCAAACAACGAGCGTTGATCCGTCGTGGGAAACACCCTTCACACATAGCGATGCTTCAAGTGTCGACTGTGTGATTGTC
ACACCAGACTGCGCTCCATCTTGGAACTTCTCGATTGAGAGTGTCTTCGGTCGGATTTGAATGACTGATGTATCTCCACTAAGTGCACGCTGCATGTTGC
CCTCATGTAAAATGACCACTCCTTCGACGGTGTTGGCGTACAACGCAGGGTGGGCATTGCTCCAGCCGATACGTGTGACTGCACGACCCACTTCTGCCGT
GAAGAGCAAGTCCCATCGGTACGACACATTTGCGGAGTCTCCAGTACCTTGCGTCGTGTCAATGAAAGACGTGGCACGCCAAAAGAAAACTGCCCCTTGA
GCTGTACCCGCCACGAGAACGCGCCTTCGCGGGGAAAAACTCAAATTGTTGACGTTGTAATTGAGTCCACTTGACTTTGGTAGACTCAATACACTGTTCT
CTTCAGTACGAATGTTCCAGAACCGCACAAGTGGTTCGCCAGACGCAATTGCTAGTAGCCCCGGACTAGCCCACTTTGTTTCCAGCAGTGAACCTTCTCC
CGCTAGACTCAGCTTGACTTTAGTAATTGGCTTTACTGTGCCGTCCGTGACGCCCACTTGATACACGATAAGCTGCACCGCCCGTGTGATGACAATGAGG
CGGCTTTGCTCCTCGAAAAACATCATCGACTCTATTGCGTGGTTTAGCACCTGAATGTCCGAAATGTGGCCCAAATCGTCGGCATAGTGTACAGACCCCA
TCTCACCACCGAAAAAGAACTGTGGACACGCGTGCTGAGAAAAATGCTCCCTAAGCAACACAAAGACATCAAAATCGAGGCAAATTAGCGCAATAGCTAG
CAGAACCATTATGGAAAGTAACATATACTCACATTTTGGTGTGGCTGTCCTTTGGTGGCGCTGATCGAGTGGCGAAGACACAGTGAGTGAAGCTACCTTG
ACGCGCATATTGCGTACTGAGGGTTAGCTGGCACCGACTATCCACCTTCCACACGGCAAATATTCCGTTCTCATCCGCAGACATGAGTCGATTCCCTGAC
GGGGACCACTTCAACAGACACACGCGGCTCGTGTGCGGCGAGTTCACTTCGCGCGCCGACTGTTCCTTGAATACCCACAGCGAGACCATACCTGGCCCGC
ACAAGCCAACAAGACTCAGTGCGCGTTGATAGTATTAATTCAAAGGCATCCAACATACCGTCGCTCCATCCGACCGCGACAGCTCCGCCACGAGGCTGCC
AGGCCATCGAGACGATGTCGGCACTGCGCGAATAGCTCTCCAGACCTTGCTGCTTCTCACCCTACATCGAGTAAGGGCCCATGCAACCGGTTAATGCTTC
GGATCTATTGGTTACCCACCAAACTATTTGCTGCCAGTACCTCATCCGTGAAGAAGTGAATCTCTCGGTTCTCCAGCGCCACGGCCAGCACCGGGTCCAG
CTCTCCCCAGACCGAGCAGACCTGTCGCAAATTCGCCGGCACCTGCACATTGTAGTCGTAAAACAATGCCATCGTGCACTCTCTCGCCTTGCCGCCACTA
GATCTTCGAGTGCATTGCTCGCGTCGCTTCAAGATACAATATGCATTTGCATAGGTATGCTTCAACATGGTTCATTATGTAGTCCACATTACGTGGTGTC
TACACACACCACATTTGATCGAAGTTTGACTGGTTGGGCGGCCACTGGTCGTGAAAGGCTGCGGGGCATTGCTGCATACTCAGGGACTATGGCGGTGCAA
GCGAAAACGTCGGAGCCCAAGGGCAAGAGCTTCACCAAGGCCAAGAGCTTCACCAAGGCCAAGAGCTTCACCAAGGGCTTCAGTGGCAAGAAGCGCCCGG
CCGGTGGCAATGGCGAGGACGGCAAGAAGTCGTTCATGGACCAGAAGCTGGCCAAGAAGCAGCGCAAGATGCAGCGCCCGCACTACGAGATGGTGACGCG
CGCCAAGCAGATCTGGAACGTCATCCGCGAGCGCGACGTGGAGAAGAGCAAGCGTGCTACGCTTGTGGATGAACTGTACACGCTGGTGAAGGGCAAGATC
TATGACGTGGCGGCGAAGCACGACGCCTCGCGCGTCATCCAGTCGCTCATGCAGTACGGCAAGCCCGAGCACCGGTCGCAAATTGTGCTCGAGATGAAGG
AGCACCTGATTGAGGTGGCCAAGATGCAGTACGGATGCTTCCTCGTGCAGAAGATGATCCGCTACGGCAGCGTGTCCGACCGCGCCGCCATCGTCAAGTG
CCTCTCAGGCCACGTTGTGCAGGTGGGCACGCACAACATTGCGGCTAATGTGCTCGAGTATGCACAGGAGTATCTCAAGCCGTCGCAACTTACGGCGCTC
AAGCTCGAGTTCTACGGGCGCGAGTTCGCCTACTTCCACGAGGAGAGCAAACGCAACCTGGCTGACATCATCGCGGCGCACCCGGACAAGAAGGCGGACG
TGCTCAAGCATCTGAGCACCATTCTCAACCGCATGGTCGACAAGCAGCTTCTTGGTTTGGCCTTCGTGCAGTCCCTGCTGTGGGAATATCTGTGCAATGC
TGAGCACGACGACGTGATGCAAATGGTGGCGAACGTGCGTGACGCTTCGTTGGCTCTGCTGGCTACGCGCAACGGTGCTCGTGTAGTGAACAAGTGCCTG
TCGCTTGGTGCGGCCAAGGACCGTAAACGCATTATTAAGGCTCTCAAGGACAAGGTGCTGGAGGCTTGCAACCACCCCAGCGGTTACCTTGTGATCATGC
GCATCCTGGATGTCGTTGATGACTCGGTTCTTGTGCAGAAGTCCGTTCTGGCGGAGATGAACGACGAACTCTTTTCGGTGGCGATGCACCCGAGCGGACG
CAAGGTTCTACTCCAGCTGCTCAGCCCGTCGAACAAGAAGTACCTTTCGCCGGATGATCTTGCCCTGTTGGAGCCTCCCATGCTTCCGTCGCCTGAGGAC
CCGAAGGTCTTGGTGGTGAACTACAAGAAGGACCCGGACGCTCGTCGCGAGGAACTCCTGAAGGGTCTCCTGCCCAAACTGGAGGAGATGTGCGTGGAGA
ATGCCACTGCCCTGATGCGCTCGAAGGAGGGTCGTGACGTGATTGTTGAAGTTGCGAAGCGAAGTCAGAGCTCTGATCTGGCGGACAGTGTGGCGGCCGC
CGCGTTGGCGGAGCCTATCGAGGAGGAGGAGGCGCTTCACACTGATGCTAATGGCCACTTTGCTTTGCGTCGTCTGATCAAGGAAACTTCGCTGGCGGAG
CCTCTGCTTTCGGCCGTCGAAGGTCAGCTTCCGCAGTGGGCCTCCACCAACCGGGGTTCTTTCGTGGTTCTTGCTTTCCTAGAGGCTGAGAAAGGACCCA
AGAACGCTGCTAAGGTCGTCAAGAAGGCGCTCAAGCCTGCGATGGGAGACTTGAAGAAGCTCGTCGACCAGCAGAAGGGCACTAAATTACTTGTCGAGAA
GCTCCAATAGAGAGGAGATAGCTCAAACTTTATAGATCCACAGGTTTTGTTTTCGTTGTGCACGCTCGTTTGGGTTTCGGACAATATCTGGACTACATTT
AATCCTGGTCGTCGCTATCGTCTTCGCTATCGTCGTCCTCAGATGTATCTGTAGCGCCACCTTCTTCTTCGTCGCCCTCCTCGTCGCTGTCGTGAAACGC
TACAATGGGGTTTCCTTCTCGCCAATTCTTCACCAGCTCCAAAATTTGTGGATGCTTGTGCAGAAAAGCGAGGTAAGAGAGCGTTTCTCCAAACTATTCG
AGCATTGTCTTGGGTTAGCGGGCATGTTTGATGATAACTTCAAGATTTTGTTGAGTTTACCTTGTTCGGTTTATCCGCCAGCTCGGCATCGCACTGCTGT
AGCATGTTCATCAGTAGATTTACGTTGCCACAGGTGGCCGCGTAGTGCAAAGCTGTCATGCCTTGGGCCTGTCGTACCACAACGACCGCTTACTCTTAAC
CATTTCTGCCGAATAATGTTTTCAGAATTTTGCTGTGAGTCCTTGCACGTACATCTTGTAAGGTGAGATCTGAGCCAGCGTGCAGGAATACCATGCCTAG
TTGGTGTAGAGGTGTTCCTCCTTCAGCACAGAGCATCAGTGGCGACTGTCCAAACACCTATGGTAACGCGTGATAAACAATATCCTCTACAGAAGCTTAC
AATGCAAAGTACCTACGTTTCGTGCATCAACCGAAGCGCCGAGCTCGATCAGGGTTTCTGCTGCGAGCTTGCTTTCACCGACGACCGTCAACATCAATGG
GGTTGTACCCCACCGGTCTTGAACATTCAAGTTGGCACCATACTTGGCAAGAAGACGCACGATGTCTAAGTTACCAACGCGACTTGCCCAATGCAGTGGA
GTCCAGCCATCTCTCTAAGCAGCGACAAATATGCCGCAAGCACTGCGTTATTGTCTGCACCGTGACTGACCAAGCTTCTTGCTGAAGCACAATCTCCGGC
GTCAACGTACATCTTTCTTGCCGATCGACGCTCCCTTTTTCAGCAAGACGTGACAGATGCTCGTCCGGTGCAGCGTGCACGCCCAGT