Description :
From Genome Similarity Track
Location :
Scaffold_205:42927- 44687
Sequence
1760 bases(100 bases per row)
AACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGGTCGGAAAGCCCTTTCCTCCCAGG
TCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGC
CCAGGATAGACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGCTATTAGACACGAGGAACCTACCG
CTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACC
TTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGGTTGCTGACTCGCAGACCCCCCTTGACC
CAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTAC
GCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAG
GCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAG
GCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGG
CCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGACTGGCTCT
CGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGC
AACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCG
AAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCC
GCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGAATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGG
TCCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAA
GAACTCCATGTGGGACAGTTCTCGGGCATAACCCCAGGGGTATCCCCAAACAGGATAGAGACCAACCCCGGGTCTCGGGCTTTCTTACGACAAGTCGTGA
AGTCTTTAAGGGGAAATGCGGTGTGGCGCGAGAGCACACACCGAGCAGTCTCCACGTTGTCGACGAACAACTGTTCCTTTCTGAACAAGGGCTCGTTCAT
AGATGCCCCTAGAAGTGTGCCGCTCCACAAGTCACGAGGAGCGACGAGAAGCTCTAAGAA