Description :
From Genome Similarity Track
Location :
Scaffold_144:42926- 45001
Transcript NameFunction/comments
Phyke_g5020myosin-like protein

Sequence
2075 bases(100 bases per row)
CCAGACGGCATTGAAGACATGACTGCACTCAACTATCTCCATGAAGCTGCCATTTTGTACAACGTGAAAAAGCGGTTCCTACAGAAACTTCCATATACGT
ATACAGGGGATATTTGCATCGCTGTGAACCCTTATCAATGGCTTCCAGAGCTGTATACAGAGCAAATGCAGTCTCAATACCTTACAAAGGCTCGAGACGA
ACTGCCACCACATGTATACGCTACCTCTATGGCATCGTATAATGATATGAAACGTCATGAAGTGAATCAGTCCATTCTGGTGAGTGGAGAGTCAGGAGCT
GGCAAAACGGAGACGACCAAGATCCTCATGAATCACCTGGCGtccattgctggtggacTGAATGACTACACGATTAAAAAAATTATTGAAGTGAATCCAC
TGCTCGAGTCGTTCGGTAACGCCAAGACTGTACGCAATGACAACAGTAGTCGCTTCGGCAAGTTCActcagctgcagtttgatAGCACTGGTACTCTTGT
GGGAGCAAGATGTCGAACATATTTGTTGGAGAAGACCCGAGTGATTTCGCACGAAGAACAGGAGCGTAATTATCACATTTTCTACCAACTTCTGGCAGCT
GGCGACAGCAAAAGGTGGTTCCTAGATGATGCTAACGAGAGCTATACATACACGGGCGATAACAGTACCAAGAAGATCGAAGGAATGTCAGACGAAAACC
ACTTCCAGCGTACTAAAACGGCACTTGGTCTTGTTGGCGTCTCGGAGCAAGGACAAGAGACCCTCTTTGAAGTGCTCGCAGGTGTGCTACACCTCGGAGA
AGTGCAAATTCAGTCGAAAAACAACAACGAAGAGTCAGCCATTGAGCCAGCTGACAAAGGATCGGAACACGCGACTAAACTGCTGGGAGTATCGGCTGCG
GACCTAGACAAAGCTTTGTGTTCGAGGCAGCTTGCCGTAGCTGGTGAAAAGGTGACGGCCTTTTTAAAGAAGGAGCAAGCAGAAGAGTGCCGCGGTGCGC
TTGCTAAAGCCATTTACTCCAATGTTTTCGATTGGCTAGTAGAAACGATCAACACGTCCCTGGAGAATGATAGGAAGATGCGCCACCACGTCGGCATCCT
GGATATCTTTGGTTTTGAACATTTCAAGCATAATTCCTTCGAGCAGTTCTGCATTAATTACGCCAACGAGAAACTCCAGCAGAAGTTCACACAGGATGTC
TTCAAGTCCGTACAGATTGAGTACGAGGCTGAGGGCATCATCTGGAGTCATATCGACTTTGCTGACAATCAAGACGTGATTTCAGTGATTGAAGACCGCC
TCGGCATCATCTCTCTACTCAACGATGAGGTAATGCGTCCCAAGGGCAACGATGAATCGCTTGTATCCAAGCTCTCGACTATCCACAAAGACGAGCAAGA
TGTTATTGAGTTCCCTCGTACATCGCGCACGCAGTTCACCATCAAGCACTACGCTGGAGCTGTCACCTACGAATCGATCGGCTTTTTGGAAAAACACAAG
gacgctcttcttccaggtCTTTCCGATTTAATGAGGGGATCGTCGAAGTCGTTCTTGAGAACAATTTTTTCCGAGAAGCTTGGCAGCCCCAAAGAGGGGC
CAAGGAAAGCAAGGAAAAGCATCGGGAGTGCACGGGGTCTAGGTGGACGCGCTATGGGAGGTGCGCTAACGGTAACGAACGTCGGTACTCAGTTTAAGGA
CAACCTGAATGAGCTCATGACAAGCATTCGTCAGACAAAGGTGCACTATGTGCGTTGCATTAAGCCCAACCAGGTCAAAAGCCCGCGCGAAATGGACCAG
CGGATGGTGGTCTCTCAATTACGCTGTGCTGGCGTGATCGAGGCGATCCGAATTTCACGTGTAGCATACCCGAATCGACTACTGCTAGAAGAACTGGTGG
ACAAGTTTTGGGTTTTCGACGTTCAGCATCGCAAAACCGACATCTCTCTTAAGCAACGATGCGAGGCACTGATGGGGAAAATGGGGCTTTCGTCACCAGA
GCAATTTCAGATTGGTATTTCGCGCATTTACTTCCGGTATGGAATcctggagcagatggaggacaAAAAGACTGA