Description :
From Genome Similarity Track
Location :
scaffold_3:42912- 44789
Transcript NameFunction/comments
g6074.t1hypothetical protein
g6075.t1 hypothetical protein PHYSODRAFT_330557

Sequence
1877 bases(100 bases per row)
GAGAAGGCCGCTCTCGCGGGCTTTACCGCCTACAGGATGCGCCGGAGACCTGTCACCGAGCGGCTACTATCAGACACAGCCTGCCGACGACGCCAGCCAC
CCGATCAATCAAGCTCGAAGCGGACCACAAGCTTTTGTACTTGCGACAAGATGGCTCTCTCCTAATGGCGCCCTCTTTCGGCACGAAGTACGTGGCCATA
CCCTCCTGGTTCTGCAAAGGTGCACGTGTGCAGCCGTATCCCATTTGGTAGGTTGAAGATATGTGGTTCCACAGGTTGGTTTTGAATTCACGACGCGCGC
GTACTTTCTCGGTTTTCCCGCCCTCAAGCCTCTGGGCTAGCAAATACCTGGCATTTACCAACTGGAGCATCGGAGCGGCAACGGAATCTTCGACTGAACC
ATGACGATCGACAGGTTCTACGGCAAAAAATTGACGAACAAGCACTCGCAGACCGTGGCGGCGCTCAAGAAGAAGGTGGCCGAGCTGAAGCGGGACAAGG
CGGCGCTCTCGCAGGACAACGCGGAGCTGCGCAACGCGCTGCTGGCCAAGGACGAGCAGATGGCCGAGCTGCAGCGCAAGATGGAGACACAGGCCGACCA
GGCGTCGACCCACAAGAAAGACATGGACGCAGTCGCCCGTCTGGAGCAGAAGGTGGCCGCGCTCTCGCAGCAGAACGAGCTGCTGGCCGAGGAGCTGCGT
GCGAGCAAGCAGCAGCAGCAGACGGTGGGCAATCTGACGATGGACGACCTGAAGCTCGAGATCGAGCTACACGCCACAGCCGCAGAGAGCTGCCGGGCGG
AGGCCTACGAGGCTTGGATCCTCCAGCGCCGCCTACAGAAGACACAGGACGAGTGTGCCAGGCGCGAGAAGGCCAGGAGTGCGGACTGGGCCAGACACAC
CGAGGAGCTGGCAGAGGCCAAGGCCGACAGCGACGCCTTCGAGCAGATGCTGGTGGTCCTGATCCAGGAGAAGAAGGAGATGGAGACGCGCTACAAGAGG
AAGCTGCACAACAAAAGAGTCCAGATTAAAGGCATGGCACAGGACGCGGTGGAGCTGCATACGCAACTGGTGACGCTGGAGTTGGAGCTGGAGAAGAGGC
AGAGTGAGGAGACCAGCAGCGTCAGCAGTCCCACGACGGTGAGCTCGTGGAGTTCGACTGGGACGACGGCGGAGGTGGTGCCGGCGCAGACGCGTATCCG
GCAGCGGGAGGAGGAGGCCAGCGACAGCGACGGCATCGTGCCTAAGAGGCGTCGGATGGACAGCAACGCTATCGCATTCGAGAACCTGCGACTAGTTCGG
TGAAAGCTGGACTCGTGCATGGCGGATGGTGCAGCAGAGGCACTCATTTCTGCCTCTTCTCGTGGACGTTTCAGCTCTCCGTGGTCTGGAAGCTGCACGA
CGTGGGACTCATTTCTCCCGCATGGCAGCTCTCTAGTTGGCGAGGCAGAGGCTCATTTCTCTCTGTCGTGCGGTGGTCTGTGGCTACTCGCTCGTTGAAG
GTTTCTGGACGTGGAGTGTCGAGACTTGGTAGGCCTTACGTGAAGTTGCGCCAGCAGGCTCAGTCGATCGGGGCTCATTACCTCCGTTGAAGCTGTAGAT
GCTGGCGTGCTTCGCGGAGGTGCGGGTGTGGTGTGCTTCTGCAGTGGTCGACAGGGACTCATTACTCTCTGTTGGCCACTTTGATTGCTCACTCGCTTGC
TGTTCTACTTTGCTTCAATGCCTGCGTCCGGGGCTTTCTTCGTGTGAGGTGCCTGGATTCCGCTCGCCGAATGGACTTCTGCTACCGCTACATGCTGCTT
GATCCGACAAGAAGACTTGGATGAACAATTGCTAGCTAGGAAGACAAGTTTGTACTTTTACATATCGTAACGCAATA