Description :
From Genome Similarity Track
Location :
scaffold_188:42908- 44228
Transcript NameFunction/comments
Pl_108038hypothetical protein PHYSODRAFT_443056
Pl_108039sterol 3-beta-glucosyltransferase, putative

Sequence
1320 bases(100 bases per row)
TTGTGGAATTAGAAAAGAAGAGAAGTCTGAGGCTGGCACAAATGGTGCTCGATCACTTACGTGTAGAGCAGCGGAGTGACGGGCGTGGCGAACGACTAGT
ACTCTCTGATTACTTTTGTTCCATTACCGATACACAAGCTCCTGATGTCAAAAGCAAGAGACTTTTCAAGACTGTTCGAGCAGTGGAGCATGATCAAGTT
CTGCTTTCTGCCTTTCTAGATGAAGGTAGTGAAGTAAATTCACTGTCACTCCGTCTGGAACTCTACCACCCTGGTAGCAGTTCGCGTTGTACGTTAAAAC
TGTCATATTCTACCCTGCGTGTGGTTTTAGGGCTCCCAGCGTCAATGGAGCTGGTCCATTTTTTGAACGACACTCTAGTGGAGTCGAAGCAAATCCACTT
GATGACGCACGTCTGCTCTTTCCTTCACGTCAGCAAGATGTCTGCTATCTCGGACGGGGCTGTTGACAGACCCCCAGCATTTGCCATGCAACTTTTGTTC
GATGAACAGCGAGGAATGGAATGTATGCGGCAGCACCTCAGTCATGAAGCTACTTCTGATGAAGGAGTAGCACAAGTGTCGTGGACTGGAATGACAACAA
ACAAGGGCGGGTATTATCTCTCGCTGCACCTTCAACTGCAATACAACCAACCACAGTCTGTACAACAGACGCAACGCTTGTTGATATGCTCTGTGTATGC
GCCTGCGGAATTGCTGGTGAATACGAAAAAGTTCAAGTGGGCAGATATCCCTACTGAGCTGCTCGATCTTCTTCCAGGATCCACAGTAAATGATCAGGAC
TACACACCATTTTTCACGAAAGTTTGTGAGCACCTGCATCTGGAGGTTCAATTCGCCGACGAAAGTGATCAAGCTGATGAGTTCAACTATGAGGGTTGCA
ATCCACACCCTAGGGCAATTGAAATCAACTTTTGATCATTTTCATGTAGCAAAGTTTTGTTTCAATACCACCAGTCTTCCTTCGGTTAATCATCCCCAGA
CGTTAGTGGTTTACTCAGCAGACAAACCTTTTGTGTGTCTTGCATGATGAACTTGGCGATGTAATCCAGAGTCGCCATAAGATTACACTGTATCAGCCTA
AATGTAGATTGACGGTTGTACTCGGCACTATTTTCTTGGACGTACGCAAGTTCTTGCCCTGCAACTTCATTGAGAAAACAAGCTTGCATTATATAATCCA
ACGTCAGAAACAATGCATCACACCGTTCGACAAGAATCGCGCCCAAGTTTGGCTGCTGCCATCGAATCAATAGCTGGAAATGAACTGGACGGGCTTCATA
CTACGGCGATCGCTCTGCAA