Description :
From Genome Similarity Track
Location :
Scaffold_830:429- 2579
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_830-snap-gene-0.3Myosin

Sequence
2150 bases(100 bases per row)
GGCGTTCCACAACATGAAGAACCATAAGATCCCGCAGAGTATCCTTGTGAGCGGCGAATCAGGCGCCGGCAAGACGGAGACTGTGAAGATCATGATGGAG
CACCTCGCGAGCATCTCGATCTCGAACGCTAAGAAGACGCAGGAGCTGAGCGACGCGCAAGTGAACGGCACTACGAGCGCTTNNNNNNNNNNGATTGGCC
ACGACACGATCGTGCAGAAAGTGCTGAAAAGTAACCCGTTGCTCGAAGCGTTTGGTAACGCCAAGACGATTCGCAATGACAACTCGTCGCGCTTCGGAAA
GTTCACGCAGCTGCAGTTCAACACAGACTACTGCCTGATCGGCGCCGAGTGCCGCCACTACCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
GAAATCGCGCGTGATCGCTCAGGCAGCAGGAGAGCGCAATTACCACGTGTTCTACCAGCTCGTGAGTGCAAGGGAGGAGCGATATGGCTTTAGTCCAACC
TCGTCGGCGGCAGAATTTCGATACCTGCAAGACGAACCGCTTCTGCTGGACGGCCAGACGGATCTCGAGCGGTATCAGGTCACCCGAGACGCCTTGACGA
CCATCGGTCTCAGCGACACCGAACAGGACGACTTGTTCCATGCGCTGTGCGGTATCCTGCGCCTCGGTCAACTCGATTTTGTGCCTCTCGAGTCCAACAA
GAACGACGCAAGCCAGCCGATGGCGTCACTCAACCCATCCGCGTTTGCAGACAACGCAATGTATCAGTCTGAGATTGAGAACCAGAAGCGAGAGATTGAG
CAGTGCGCGAAATTGCTGGGCGTGGAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCGCGTCAGGAAGTG
TACTGTGTCCCGTTGTCCAACCTTCAAGCAAGCAACAATCGCGATGCGCTCGCCAAGGAGGTGTACGCGCGCGTGTTCGCGTACTTGGTGCGTCGTGTGA
ACTACAGTATCTCCGAGTCGCCGTTTGGCTCGGCTACGGCGCCGTCGTACATGCACATCGATCTGCTCGATATCTTTGGCTTTGAGTCGTTCCAGCGCAA
CAGCTTTGAGCAGTTTTGCATCAACTTTGCCAACGAAAAGCTGCAGCAAAAGTTCACGCTGGACGTGTTCAAGACGGTCCAAGAGGAATACCAACAGGAA
GAGATCCAGTGGGAGTTCATCACCTACCGCGATAACCAAGATATGCTGGACCTGCTCGAGAATTCGATGGGTCTGATGGCACTGCTAAACGAAGAATGCG
TGCGTCCGAAGGGTAGTGACGTGTCGTTCGCATCCAAGATCGTCTCGTTGCACGAAGCGAACCCTCGACTTGAGAAAGCGCGCCTCAGTCAGACACACTT
TGTGCTGCATCATTATGCTGGCGCCGTGACGTACGATGCTGCAGGCTTCGTGGAAAAGAACAAGGATTCGCTGCAGAGTGACTTGTTGGAGCTCTTGGCG
ACCAGCTCCAACGGGCTGATTGCGATGATGTTTGGTGCGCGAGCAAGCACGGCGTATCTCACCGACGACGACCTTGCAGCTGCGCATGCTGCATCCATGA
TGGACGATGGGGGTCGACGCAGTACTTTGGGACGCAAGACGTCAAGCTTCATGCAAGAGACTGTGAGCTACAAGTTCAAGGCTCAGCTGGCGCTGCTAAT
GAGCGACATTTCGAGTACCGAGGTTCACTACGTTCGCTGTATCAAGCCCAACTCGAAAAAGAGTCCGCATGTGTACGAGATCGACTCGGTGGTGAACCAA
CTGCGCTGTGCTGGTGTCGTTGAAGCGATTCGCATCACACGTGCTGCGTTCCCGAACAAGATGGCTCACGAGAAATTTCTGCGACGCTTTGTGTTTATGA
AGAGCAAGGCAGATCCGTTCGCGATGCCGTCGGTCACAGTTTCCCAGGCGTGCGAAGAGCTCGCGCAGCACCTGCTTGCCAGAGGGTTCACGGGCAGCGA
CGAAGCTGCGACGACGCCACTATATGTAGTTGGACGAAGCTTGATCTACTTCGGCAAGGATGTCTTGGAATATCTGGAGCGGACCCGCACGATCTTTGTG
CATGACCGCGCGATCCTGATCCAACGCACAGCGCGTCGCTGGGTTGCGCG