Description :
From Genome Similarity Track
Location :
Scaffold_172:429- 1923
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19755hypothetical protein

Sequence
1494 bases(100 bases per row)
CCCGGACACAGAACGCCAGCGGCAGTGCACGCATCGATGATGTGGGGGCATACACCGTGTTTCCAGCAGTAGCAACAATCACACTGCAGTCGGCCGGGAA
CCACGACCCAGCCATCGGATGGCATGTCCTGCATCTGCATGCGCCGAGCATTAACCGAACCGATCGATTGATCATACTGCTTGGGAACGTTGGCATTCAC
TGGCAGCGGCTGCTGCTTCACAGCAAAACGTACTTCGTTCTGCGAGCGACCTGTTGGGAGCTGCGTCGCTGAGATGCACCGCCGTTCCACCAGAGTCTTG
TACAGCTTGTGCAGTCGATCCGAAACCTGCGGTGTGTTGCTGAAGACGTGTCCTTCACTGACGAAAGAAAGAAAAGCTCGCTCCATGGACTCCATCATCT
CGAACGGGGTCGCCCGAGGGTTGTCACAGTTGATTTTCAGCGTCCTGTGGTACTGCTCAAGGGGATTGTTCGTCGTGGCACACCCTGTTGGCGTGTGGAA
GACCTGCCAATTCCCGAACTCAGCGCTGCTGACCCATATCGTCTTAATATGATGCCCGAGTGCGTGTTCCGCCGAGTTGAAAGGCAGCTGCTCCCATTTA
TCCAGTACGGACTGTTTGCTCGCTTCATATTCGCCCTCGGCTGCATAGTGCAAGTCGTACATGTCCACAAAGAAGTCCTTGGTTTGTGCTGGCTCGACAC
CTTGGCCTTGGCTTTCTTGAACACGTTTTGGGTCACGTGGAACCAGCACATGAGTATTTTTGTGCTGGATATCTGGGCCAGGATAGCGTTGCGCTGGGCA
CCGTCGGCGTCCGTCATCACAAACTCGGGGGCAAAATCAATGTTAAACTGTTCGAAGAAGACCCTCATCAACTGTTTAAGGCATCAGGAAATGTCCTCTT
GGCGTCGACGCGAGATGCTAAAATACGCCAACGGGAAAAAGTGTCCACCCTTATCCGAGTACCCGATAACCATCGCTGGGAAGCACTGCTTCACGATTTT
GAAAGTTGTGTCGACGTGAAGCATCGTCGTTGCGTCAGGAGACAGTTGAACGTTGACGTAGTCTCGAAGAAGCTTGTGGCAGGTAATGCCAACTCGAAAC
GGGGTCGCTTCACTCCCGTTCCCAACCGAAGCAACGTGCCTGCCGCCCCTCACGACGGAATCGCACAAGATCACTGTGCCTGTCGGGTTTTCAGCATCCA
TCCCAACCTCATCATACAAGCGTTGGTAGCACATCTCGAGAACACGCGCCATTTCATCGGCGGGGTTGCTTCTCTTCCACCAACGCACGAAGTTGTCCAC
TTTGTGCCGGGGTGGTGCTGGTCCACGCATCTCGCCACGCTTCACCTTGCTGACAATGACGCTGAACAGGCGGTAGGCGATGGTTGTTGGAACGTTGGTA
AACTGGCTCACGATGTAAGCCTTCATCTCCTCTGTTAGTGTCGGTCGCTCTGGGGTCGGCACAACGGGATCTGCCATTATATGCTCCCCTTGCT