Description :
From Genome Similarity Track
Location :
Scaffold_197:42893- 48055
Sequence
5162 bases(100 bases per row)
GTGCAAGCAAGTAACGGAGTAAATACCTGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAACGACCAAGTTCGACATGAGCCAAGACCTCGACCA
CGCTGCCTTTCTCCTTCTCACTCGGATCGAGTGGGAAGCGCTCCACCGCCTCGCGGCGGTGTCCGGAGAAGCCGTCGTCACGCCGCTGCTGCGCTCAGCG
ACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAGTGTCAACTCCCTCGCGTATCTCCACGAATGACGTCGTGAAGCTAGAGACGTCCACCTA
CTCCGGTGCCGGAGAAGATCGACTTCCGCTGAATCGCTGGTTTCGAGAGATCGACATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATGAAGATGGCGGTCGAGCA
GGGGCTTCCGCAGTCGAACGAGATCGCGGTCAAGGCAGGGGCTCCCGCAGACGAAACGAGATCGCGGTCAAGCAGGGGCTTCCCGCAAAACGAACGAGAT
GGCGGGTCGAGCAGGGGCTCCCGTCAAATGAGCCGGTGGTCGAGCAGTTGGCGCTCCCGCTGAACACTACCGCGGTCGAGCAGGGACTCCCGCTAGAGGG
GGGTGACCACTCGTTCAGCGAGAGCGACTCATCATCCTCGAGTTCGCACTCGAGGCGGCGGCAGTCGAAGCGGCGTCGGCTGAAACCTCGCCGAGAGCCC
GTGCCAAGTGACAGCTCACCGACGGAGTCGGTCTGCGTGCTTGAGTACGTGGAAGGTACTCCCGGTCGCCGACGAACACCTGAGCTTGCAAATCCACCTA
GCGAGGCAGGGTCGATCACTCGACTTCCAGGTCTCTCCTGGAAGAACTTCCTTCGCGGCCTCAAGGGCGATGAAATCGAACAGGTTTGCCTGATCACCGA
CGCCGATTCGGCGTCGCCCGAAGTGAATGCAGTCAGTGATGGCGACGCTCCCTCGCGCCCAAAGAGCGCTGAGCCGAAGTCGGCCCGCGAGGAGCGCTTC
GCAGCGCAGTCTTTGGAAGCGCTATGCGAACCCGGCAATCCAGTCTACGAGTCCGCCCGCGAATATGAAGATGTCTTTCCGGATACGATCCCAGCTGAGC
TACCAGCTGACCGAGGAATTCGCCACGAGATCGATCTCGTGCCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATCAGGTCCAAGC
TATCGATGACTTCTTCGAGAGCCGCCGCAAGGCGGGTCATGTGCGTGAGAGCACATCGCCGCACTCCAGTCCAACCTTCTGTGTGAAGAAAGCCACGGGC
GGATGGCGCATCGTCCATGCCTTCAACAAGCTGAACGACGCTACCATCCCTGCCCAGACGCCGATTCCTCGGAAGGACATGGTGCTCGACGCAATGTCGG
GTAGTGAGGTCTTCAGTGTCATCGACTTGACCGATGGGTTCTACCAAATCCTCATGAGGCTGAGCGACATACCGCTCACAGCGGTAAGCACTCCCAGTGG
TATGCTCTGGGAGTGGCTTGTTATGCCACAAGGCTTGAAGAATGCTCCCGCCACGTTCAATCGCATGGTATCCCATGTGCTGCACCCGCTCCGCGATTTC
GCACCGAGTTATTTCGATGATATCTTCGTACACAGTCGCGCTGAGGGAGGCCTCAGCGCGCTTGAAGTCCACTTGAAGCATCTGAGGCAAGTCTTCCAAG
TGATGCGCGAAAACAAGCTGTATGCCAGCTTGAAGAAGTGTATATTCTGCGCGCCGGCGATCCCGGTGCTTGGCTGCTTTGTGAGCAAGACCGGCGTCCG
CGCCGACCCCGAGAAAGTGTCGTCGATATGTGCGTGGCCTACACCACAGAATCTCACTGAACTGTGTCAGTGGCTGGGTCTCGCAAATTATCTCCACAAG
TACACGAAGAATTACGCCGGATTGATTCAGCCGCTCTCTTCGTTGTTGAAGAAAGATGTGTCGTGGTTGTGGACTTCCGCACATCAAGCCGCCTTCGACT
CGGTGAAGAAGAGTCTCGCCGAGGCCCCAATCCTCGCGCTCCCGGATGCCTCGAAGCCTTTTCACGTCGTCTGCGACGCGAGCAATTTCGCCATCGGCTG
TGCGCTGATGCAATTCGTTGAAGAAGGTCGAGAGCGTGTCGTAAGCGACCAGTCCAGGCAGATGAAGCCGGCGGAGCGCAACTACCCTGTTCACGACAAG
GAGCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT