Description :
From Genome Similarity Track
Location :
Scaffold_1732:4288- 6950
Sequence
2662 bases(100 bases per row)
GCAGACGGTGTGAAACTCTGAGTGGCGTGTGGGTGTGGCATCGTAGGACGGCATGACGCCGCTGCACCACGCGTGCTGGTGGAACAACGAAGCGACGGCG
CGCTGCCTGCTGAACGCTGGCGCGACGCTAGTGGTGAATTCGACCAACAATGTGCGTGGAGCTTCAGTGGCGTTGGGTGCTTTCTGCTGACAACCTCAAT
GGCTTGTTGCCGCTTTCTTAGTTTGGAGCGACAGCTCTCCACGTCGCCGCCGTGTATGCGAGCGCATTGTGGCCCTGCTTATCGAACACGGTGCGGACAT
CCTCGCGAGAAATACGGTGAGGGGTTGGAGTCTCTGGTTGTTGTCCCTTCAGTAGTAAGCGAGACTAACACCGTGCCTGCAGTTAATCTCGTATGGACTA
CTTCCACTTCACTCTGCTGTAAATAATTCAAAGCACGACGCTGTCAAAGAGTTGATCGACCTCGGGACCCCCATTGACGCAGCCTTTGGCAAGGTACCGT
ANNNNNNNNNNGTCTGCTGTCAATAAGTCAAAGCACGACGCTGTCAAAGTGTTGATCGACCTCGGGAATCCCATTGACACAGCCTTTGGCAAGGTACCGT
ACTCTGCGGTCTTTCATACTGTTGTGCTGTAATCGATTGAAACGGGGCGTGTTGGATCGAGGCAGTACGACCACACAGCCTGGCATCTAGCTGCCCAAGC
CGGCAATGTCCGCCTCATGACTGCAATCGTAGAGTGCGGCGCGGACATCGAAACCCCATTAAAGGTGGTGAAAACGAGCAGCCACCTTTCTCTATCTTCT
ATCGGACTCGGCAACTACGTCACTGAACAGAGTGGAAGAACAGCTCTCTACATGAGCGTTTTCAATGGTAGAGTGGTTGCGGTTGAATACTTGCTCCGCC
GTGGCGCGCAGGTGCACGCCGCGGATGAGGTTAGTGGCATGGCAGCACGACCTTTGCCTATGGGGGTGACGATAACTGTATCATGGCGAGTAGAATGGCT
GTACCCCGCTTCATGCTGCAGCAGAACACGGCCATCTACATATCATGAAGCTCCTCGTCCAGCATGGCGGCAATGTCTGCGCTGCGGACAAGGTATGGCG
TGACGAAACCATAGTTCTCCAGACTGCGCATTGTGTGATACTCTGTTGTGGTGCTCATTGTCAGGTCGGCTTTCTCTCTTTGCACTCTGCAGCGTTGAGN
NNNNNNNNNTCATCTATATATCATGAAGCTCCTTGTCCAGCACGGCGGCAATATCTGCGCTGCGAACAAGGTATGGCGTGATGAAACTATAATGCTCCAG
ACTGCGCATTGTGTGATACTCTGTCGTGGTGTTCAATGTCAGGCTGGCTATCTTCCTTTGCACTCTGCAGCGTTGAGTGGCAATGTTCAAGCCGTTGAAT
TCGTTCTTGAGCGTGGTGCGGCAATCGACGCAACGAACCTTGTGAGTTGCATTATCTCCCCTTAGGGCGTTCCGTTTCTAACGGGATTGACTGGGAGTTG
AAAACAGCTCGGCGTGACTGCGTTGCACACAGCAGCGAGTACAGGAGTCGTCCGCACCTTGGCTCGAAGCGACCGACGAAGTACGCAGAGTCTCGTTGGT
TCGTCGACAGTAGATCCTTATACTTACTTTGGTTCATGTTAGAAAGGAGAGACTCCGCTTCACTTTGCTAGTGCCTGTGGGCACGTCCAACTCATCGGAA
CACTGATAGAGCGTGGAGCGGATGTGCATGCATCGTCAAAGGTACTAGTGTTTTTGTGCATTTCAAGTGCTGATTGCTGATGAGGTTTACCGCATGATAG
AAACGCCAACAACCGATACATTGCGCTGCGCTAGCCTCAAAAACCGAAGCTGTCGCTCTCTTGCTCGACCACGTCGGCGCAGTCGACGCGACCGAAGAGG
TATCGATTTATACTGTCGCATGCTACTCAAGATCAGGGGACTGATCGATTTCTCGCGCGAACTCTTCCGTTCATGACACAGCTGGGATGGACTGCTCTAC
ACATCGCATCTCACAAGGGGACGTCCGCACCTTAGCTCTGCTCGTAGAGCGTGGTGCGGACGTGCACAAAGCAACCAAGGCATGTGAAGTGTCACACTGA
TCAACTTCGGCCACTTGCAGCTCGCTCATGCCANNNNNNNNNNTGCTCGTAGAGTGTGGTGCGGACGTACACAAAGCGACCAAGGCATGTGAAGTGACAC
ACAGATCAACTTCGGTCACTTGCAGCTCGCTCATGCCAGTCTTTTTTTTGGGCTAGGATGGAAGAACGGGATTGTACATCGCCACGAGAGCAGGCAACAT
CGAAGCTGTGCAGTATCTTCTCGACCAAAACGTTGCGATCGACGCAACAAATGATGTACGTGGCAGTTGTGTACTACTGCCGTGCCTGATTTTGGGGTGG
TTCTGTTTACTATGCTTTGTGGGCGTGTCAGGCCGGCTGGACAGCTTTTCATGCCGCTTCTGCTACCGGAGATGTCTCCATCATGGCTCAGCTCGTCGAC
CATGGTGCGGACATCCACATGCAGATCAAGGTCCGCGCATGCTACCGCTTAGAGACTTCGGCAGTCATGTTCTCACGTGCCGGCTCTGTGTGGGCAGGGT
GGAAAGACATCGTTACATCTGAGTGCAAGTTGGAAGCTGTTCGGTANNNNNNNNNNTCGGCT