Description :
From Genome Similarity Track
Location :
Scaffold_18:428706- 434074
Transcript NameFunction/comments
Phyca_LT1534506220ATP-dependent RNA helicase DBP2, putative
Phyca_LT1534110127putative RNA helicase
Phyca_LT1534506228ubiquitin family protein, putative

Sequence
5368 bases(100 bases per row)
gaaatgacgactacttttattgcacgttagttaaaatcggtgagcgatgcggcgctaaaacatcgccagacacctttctgatagtcaccactccacttgg
aggaagatacgccaggcttcgaacgtttaccaacgaccgcggccacggccaccaccgtaaccaccacggccacggccaccaccaccgccacgtccaacaa
ggtcacgcagctcacgcggaacctcctgctcggcctcctccatgatcttcaccagaggtccagccagtcggctgttgttagcagcggtaaagaaagaaat
ggaggtacccttgttgccagcacgggccgtacggccgatacggtgaatgtagtcctcaatattcttcggcatgtcaaaattcaccacgtagcgaatatcc
ttgatatccagaccacgcgaagccacgtctgtcgcaaccaagatctgcgtcctgccatccttgaactcgcgcaaaacgtagtcacgctcctcctgcgatt
tgttaccgtggatggccttgcacatgtagcgggtgttgcgcaaattgcggctcagctcatcggcgccacgcttggtctcgcagaagatgataatacgacc
accttcgtagatgtcacgcaggtgatcctgcaacgcggagtacttctggtggtcgtccattacctccacaatctgcttaatccgcttgttggcggtcagg
tccaaagaacccaccgtcacctggataaagtccgttaagaaatcattggcgagtgccacgatctcctttggccacgtcgctgaccacatcagcgtctgac
ggtcagggcggatctggcttacaatcttgcgcaactggggctcgaaacccatgtctagcatgcggtcagcctcatccaaaacgaggtacgtcacacgacg
caggttcgttttgcccatgctcagcatatcaatcatacggccaggcgtacagatgcagatttctacaccgcggcgaaggtcagcgatctggccgcccttg
gggacaccaccgtacacgcacgtatttttgatcttggagcttgcaccgaacttgttacactccgcttggatctgcacggccaactcacgcgtcggagcaa
tcatcagcacaatcggtccatcaccaggctgcaggtaaggctacataattgacaacacaatcaaacaagttagcaacataataacaccgcgaggcaagca
cggttgcacgagaaagcaaacacaagcgagcgccgagggatttataggtgttcgcatgctgcttttcttctggccatcgcccacaacgcaccaatgcagt
tttcgcaccgatcgatcgtcagcgagcgaagatgaaagccatctgaaagtgtgtcggttgtgccggaccaatccatcgaagtaagtcggtggctcctctt
cctttgcatgtccgttaccatgcaatagttagcagaaagagacgctgattccaccaactcgaccggcactcctacacagcagtctgcgattcaatcaact
gaagtgacgaaagacacataaatgccgccaaatggagatataccccaaaatcgcgcacctacgtgaatcgaccacgctctgaagaccgttgtaaacccca
cgtcccacgcgcgtgcgtctcgttcagcgcattatacaatcttgcgcgtgaacggccattgtgtactcaacacaacttgcaatcaaattccatcagcgcg
ccaacgctgcggaagatgtgtccgccaacgaaaataccctctcaattgagttctgcaaattacgaacctgtgcgttaatgtgcacgatcgcggggagcaa
gaaagccaaagtcttgcccgaacccgtcgccgaaattcccaccatgtcacgtccagaaagagccatcggccagccctggcattgaataggcgtaggtttg
tcaaagccaagacgcaccacctcctccagcacgtactccgggaaagaagcctcctcaaacgacaaaacgcacttaggcaccccctttccagccacaatga
tctggttgtcgcgcttccactgctcatactcctcctccgagcgcttgctgacgtccgggtgctcgtagtagaagtttttctcgaaaaccggcagtttgga
caggtcccactggatgtgcgagtctaggttggatcccaggtcgccaccacctccaaagccgccacctccacggcctccaccgccgtagccaccaccaccg
ccgtagcctccgccacctccgctgtagcctccgcctccgtagccgcctccaccgccactgtagccgccacctccaccgcgagagcctccatagcctccgc
cgtagcctccgccgctgcttccaccatagtcgcgacgcgaggaagagtcgccgtatcggtcaccgccaccgccgtacatgatcaagagtgatggtctttt
ggtcgcttgcgcactacaggtcgtttcggcgaatggtgaccagggcgacagggcataggagcgatcgctttgaacagggaacgttaaacaggcgcttttg
gttggctaccggaaaaacgaaatttcaggcaatcagattgcaggatgacgttgattggacagaaatttggatgttgaagagttcaagagcccgttgtatt
gtgcacaagagcagaagacgtggaacggggtctttgcagcgctccaaatgggatgggataatcattctgtggacagaatacctgggtggggggcccgtcc
ttaagaaatccttctacgcgagaatggtgcgctcatacgaggcgaactgctgattggcctctgaaatgctcacttcaattttccgcacaccgcgctcctg
caatagtaaaccacaacaggatataattaacacaaaccgtggcgcatgggcatagattttcgtaccaatagcgcaacgagcgtgaaggagtcaacaagct
ggttgctctgtaaatggcaaaagcgtaagcgacgtcagcgatagtgtagatcccgtattgcaggtacgtacaatgtaaatggccagctcttcagccgatg
agtgcacgataggaagtagcgagcagtctgccttgggaaagctgaatttggccatgtcttcggtcagaatatgaacattcgtgccatcaaacgaaatctg
cgttcaacgcataccacgtcagcatccaatagtacgaagcgatcagtgcgtgacttcttaccttcagagaatcgctgttcatcggcacaaggaacgattc
attcagatctttgcaaatgacccgtgagaccttcttgatttcgccaaagtccaccacatatccatccggaccaacctgcccagtgatcgtaacggccaag
cgatagttatggccgtgaagtttttcgcggaatccctacatgcatgcaagcgttaaatactccacccagtatagttccacttacaatcgtgatgcgtacc
ttgtaggcaatgaagtgcgcggcgttaaacttcatataatccttggacacgtgcaccttaaacacctcgttgtagccgttactcaaccggttgggtgtgg
gcactacgtgagttgccggtgcttgcacttctgccacatctgcaggtgcagggggtgcattagcctctacagaactgctgggctccgtcgccttcgctgt
ttgggcgctcgaagtaccactggcgataccccggaacggctgaatctgcatcttgatctcttctggtgtcttgacgcaaccgcgcaagtgcgacgcccag
cggtccacattgcgagacgtgatctccttttcacagtagcagcacttgaccgcgtcggtgctgcgcgtcacgtacatcttgacgatggacttctgctcag
cggtgagttccttggccatggtagatccgggggagttgcgtctgcgtcttttggtctccggtgtggtctgctgctcgccgatcctcttgtgttcctcgtc
agccgacagcatcaggtccaagagctactggacgcccgccgacatgaaaaacgatgctgtagcgattttgattggcagaaaggaatatatggtgtatgtt
acacaatctcacagattgaaaagcgaaaacaatgacaccggagggcggaaatatataaggatgcgtgtcagcactttcaagtagcgcttcacttgcaaac
aacttgggcgacacgctggcgacgacgccctattggtcggagacagcacgcggcaccacactgagaaagaaattcatgctcacgccgagcagcaggccaa
ccttttgctttcgaggcaccgatcggtcgagtagctggtgcaacgagaaacgcatcaacgagttagaaagcaacccaaacaagttagcaacagtagcaga
gaagaagtactcaccatcagaagcataaatacaccaagcaggaggcccattaggaacccccagagaaactcagtgccagtgccttcattatcagccgcga
gaatcgagttgttcatgccgttcatgtcgatttgcgtatccatcgcaatgcgcgccgtcggaacaacattgagtgctgaaaacaaccatcgcatatgctt
gacacattagtacttctgaatgtatcaacagcgaaaattccttgaacaagttcgtaccaaactcggactgcggtccttgtgacgccatccactcctcttc
aagtcgatatatccggtcttcactgctttccccaggaacacgttccgcctggctgatatacacggagagctgcgggtagaagtacaggcgcagcgcctgg
atttcttcacgactgagtcggtcacggagcctgtcgaagcctctcctcgtggatgggtcgtctctttcctctggttcactctccgcagctgccatctaca
gtgtatacgcacaagtacgttgttaagcactgcgaatataattgtttccaccaaaacggctctcacctgattgaccacggctttcggcggtgccgagctg
atggcacaatgaataaagtcctcattcttcaccttgcagctcgcgagtgtcaccttgtcgtccgacaacatcttgccctggtggattagccgcagaaact
taccctctgcattggatttcttcttcacaagatccttgagctcccccacactagccgagggtgcgatctccacacgaagcggcttttcactgagggtttt
aatctttagcacgatcttgccgttgttgtcttcattaatcgtgatgttcacggaatcttctgacaactaaaataaaaaatatcatacattcattaaaacc
cactgttttctccaacataataacctaaacaacagaccacctaccagcggtttctcctccgtaatgttctcggtgtgttcaggctccatcatactgctca
ggtcgatcgctagggcgtctacacgcctctccgaccgctcagcgccctcttcctctgcgctgtttttt