Description :
From Genome Similarity Track
Location :
contig_61:42860- 45654
Transcript NameFunction/comments
g9183.t1mannosyl-oligosaccharide alpha-1,2-mannosidase, putative

Sequence
2794 bases(100 bases per row)
ACGCGGCTCGTTCTCAATTGACACGCATAAAGTTGTTCCTCGTCATCTGCCCATGAACACCATCCACTCCCTCTAATAAAAATTCGATACTGAACCCCCG
CTCACCCCGCCACCTTCTCTCATTGGCTAAAAGTCATCCCTTGTCTTTCAACCCCATTCCCGATTGATCCCCTCGGGACGCACGTCGCCAATATGGAGCC
GCGCGCCCGCCGTCTCAGTAACATCCGCGAGCCGCCGCTGGCTCCGACGTTCCCTACCAAGAGCTTCAGCCATTCGAGCAGCAGTCGCGGCCTCTCGTCC
TCGCGCTCGTTGTCCACGGCGGTGGTGCTGCGACTGCTACTGGGGCTACTGTGCGTTGGCATCGTCTTGCAGTGGGTCCTCTGGAGCTCCAGCGTCGTGG
AGCCGCAGCGCAGCAAGGAAGACAACGGCTGGATGAACCACTTGCGACGAATTGAGCACGCGGCTGACAAGGAAACGCCTGAGCCCGCCGCTGACACGTT
CGAGTTCGAACCGCCCGCCAGCGACCCGACCCACGAGGAGGAGCAGCGACGACGAGCACCGTACGATCCGGCGATGCACAATGAGGACCAGAAGCAGGTA
GTCGAGATGGTACAATGGGCCTGGAAGGGCTACTCCACGTACGCCTATGGCCACGACTCGCTGAATGTCAAGACGTACAAGGGCACTGGGCTGCCAGATC
ATGACATGGCACTGACACTTGTGGACGCGCTGGATACACTATACCTCGTGGGTATGTTCGACGAGTTTGATCGGGCGAGTGAATGGGTGGCGAATAATAT
GGAGCAACGGATTTTCCTCAGTGGCTTCATCAGCTTCTTTGAGACGACGATTCGCCTGATGGGAGGACTCTTGTCGTCATATTATTTGTCGGGGCATGTG
CATTTGCTCACAATTGCGAATAAGCTGGGCATGGCGCTTTCTCCAGCGTTTGAGGTGTATGAACACGGTATTCCGGCCAAGGACTTCGATATTGTGGTAC
GTGGCATTCGGTGTCTCTATAGGATTTTTTTGTAGGATGCAAACGAAGGAAAATAATTTATTTGTGTTGCTTGGTGTGGTGGTGCTTAGACGAAGCGGAC
ACGAGCTGCCCCCTCTCTAGCAGAAGTTGGCACACTGCAGATGGAGTTCAAGTACCTCACTCGACTGACCGGATACCCGAAATACCAAGAGCAGGTCGAC
CGTATTTCGGATTCAGTACGTTCTGTTACTAATAGTGAGCGCTTGTGCTGCTTACGATGGACTTACCTGCCTACTTCTTCTGCTTGTTTATATCATGTAG
CTTGCGAAGCAAGTGGAGGAGAAGTACACAAACGGTCTTCTGCCGGTTCAACTGAATCAGCAAAACGGAAAAATCACCCAGTCGAAAATCACTCTGGGCG
CTAATGGTGACAGCTACTACGAGTACCTGCTGAACAGGTAAAGTGTAGTGGTCGAATGAACTTAGCTAATGCGTGGCTGACTCTCTTTGCGTTGTTGATA
CGCAGTGGCTCTTGTCGGGCAAGAAGGACGACAAGTTCAAGACGCAGTACATGACGGCAGTGGATGGAATCATAGACAAGCTCTGGGTAAGTCAAAGCCC
AATGGCTTGGTATTCATTGGAGAGCTGGTGTACGGCAAGTTCGAGCCCAAGATGGACCACTTGGTGTGCTTCGTGCCAGGTATGCTGGCGCTAGGTTACA
TGAACGGCATGCCTGAGGAGCATCTCACGCTTGCGAAACAGCTCATCGAAACGTGCTACCAAATGTACGCTCAGATGGAGGCTAAGCTTGCCCCCGAGAT
CATGTATTTCAACATGAAGGAGAACGTGGAAGAGGACTTACTCGTCAGCGCCACTGACGCTTTCAACTTACTGCGTCCCGAAACGGTGGAGAGCTTGATG
GTGCTGTATCGTGCCACAAAGGACGAAAAATACCGCGAGTACGGTCGTGATATCATGAAAGCATTCGAAAAGAACTGCCGATTAGACCGAGGTGGCTACG
CAAGTATTGGCAACGTTGCCAAGGGCCCAATTCACATTGGCTTCCGCAACGAAATGGAGAGCTTCTTCATCGCTGAGACGCTCAAGTATCTATTCCTGCT
GTTCTCGGACGACTCGATGCTGGCCTTGGATGAGGTTGTGTTCAACACGGAAGCCCACCCGTTCCCGATAGACAAAACCAACTCATAGATATGTGAAGGA
CGCGTCTCCAATATTCGTGCTGCATTCTCGGTGTTGTGCTAATCCAATTCGTGTAAATCGACGAGTGGAGCTTCATGTTAGATTAACGGACTGGCCTCTC
GTCTGTGGTATTTTCAGCAGCTCTAACGAAACGATTCCTGAGAGGCAGTATTGATCCGTCATTGTAGATGAGCTCATCCCGAGGTGCAAATTACAGATGG
GTGGTGCAGCGTCTGTCCTAGGCGAATCGGCCTCAAATTTGCACTACAGATATGGCGAGGTTACAGACGTGCCAGGCGACAAAGCGGATGAGGACCCAGT
GTCCGCAGCATGGATCGGCACGAGGCTGGACATGCCGCCGAAGCCCTTTAGCCTCGAGAACTACTTCGAGTTGTTGGACATCGTAGGCACTGGTATGCTG
GGCAAAGTACGTCTCATTCGGCACAAGCGTTCAAGTCTGTACTACGTGTTGAAGTCGATCAAGAAGAAGGAAGCGATTGTCAAGAAGATGACCCTGCAGC
TTGAAGCCGAGCGTGACGCGATGGTCCAGATGACAGCAGTTCGACATCCGTTCACGGTGCGGTACTTCGGCAGTTTGGCCACGTCTTCGCATGT