Description :
From Genome Similarity Track
Location :
Scaffold_2095:4285- 5544
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2095-snap-gene-0.5RNA polymerase II-associated factor 1
Pytiw_DAOMBR242034maker-piw_contig_2095-fgenesh-gene-0.0Serine/threonine protein kinase

Sequence
1259 bases(100 bases per row)
GTCCACTACCGCCACATCCGCCATGCTTTCTCGCAGCGATCGACTGGATTGCTCTTGCTAATTCCGATACAAAAAAGCCCAACCAAGGGGGAAAAAAAGC
GAGCGCGAAATGGCACAAAAATATATACAGGCTGGTACTAAAGCGGGGGTTTGCGCAGTTTAGTGACATGACTATTGTATGAAAATATAAAAAATGATGG
ATCTATAAAACAGAATCATATCAGAGTATGATACTATTTTATGCTTTATATAATAGTCATGAGTCTATATATGAAATATCTGGCGGCTGAATATAGCTGT
TCGGAAGTGCAATGTGAAGAAGACGACTTGGTACAGTACCGCAGCGCCCACGTGGTGCGTGCATGTCGTGACGCCACTCGGAGCTTCTCTCCTCCCGTAC
GTCCCCCACTACAGCACAGACATCCGCAGTATGCTGCGACCCGTGCGCAAGCTGATCCTGCACCACCCGGGCAAGCTCACGGCGTGGCTCGTGGCGTTCA
GCTCCATGTACACGTTCGCGCGCGTACTCGTGCTCCAGTACGCGCTCGGCGCGCTGCACTTCTGGATCTACCGGTACCCGAGCAACTTCCCGCACGTCGT
GTTTGTGCCGCTCTTCTACGCCTCGGTGACCATCGCGTTCTTCGCGGCGCTCTACCACGACTGCGTCGTGCTCCAGTCCGGGCTCTGGAAGTACGTGCTG
CCTATCCCGCTCACGGTCAGCGGCCGCCGCTTCCGCATCGTCGGCGTGCCCGCGTACGCGTTCGCGATCGCCGCGATCGAGGCCGTGCAGTTCTTCCGGA
ACCCGAGCATGGAGAGCGACCTCAGCCGTCTCGCCGTGTACTTCCAGGGCCTGCGCGACAACGTCATTGTGGACGACCTGCTCATGAAGAAGCTGCTCTT
TGACATCAAGTGGCAGGCCTGGACGCTACAGACAAACGCGAGTCCCACGACCGCCGCGTACATCCGCTTACCACTCGAGTTGGTGTGTGCGCTGCCTGTG
TGTATCATCTACGGCATCGCGATGTTCTGCAACGAGCCTGGACAAGGTGCGTCTGCATTAGTGAGCGGTGTTCAGTGCACGGAGTCGGTTGGTTTTAACA
CGTATACTGTTGTTTTATGTAGATGGCGAGGAGCTCCGCCAGGCCACGCGTAACAACGACCTGCTGCGCGTGAAAAACATCCTCGCGCGTGGCGTGAGCC
CCAACAGCAAGTCGGACGACGGCTCGACGCCGCTGCACATCTGCGCGCAACAGGCGCTT