Description :
From Genome Similarity Track
Location :
Scaffold_2:4284537- 4288449
Sequence
3912 bases(100 bases per row)
AGCCAGAGCAAGTCCTTAGTGGCTTCAGCCATGGCAACATACTCAGCTTTACACGTGCTCAGGGTGTTGATTTCTTAGATGCATACGACACCACATTGCC
ATCCAGCATCGTAACATATCCACTGATGATCCGCCGATCTTCAGGGTCATTTGCATAGTCGGCGTCAGAGTAGCAGCTGATGTGTACTCCATCGCCTTGC
TCGACAGTCATAACAAGTCCGTAGTCGCATGTGGCCTTGAGATACCGTATGACTCGCTTGGCCTGAGCGTAGTGTGTATGATCATAGTTCGCCAGAAACT
TGCCCAGATGCCGCGTGGCGTGAGCAATGTCAGGCCGCGAAGCGCTGGCGAGGTACTGCAGTGCACCGACAAGTTCTCGATACGGCAGGTAGCCAGTCGC
AGCTGCCATCGTCGCCGTCGAAGGTGTCGTCGCCTCAGGGGTCGCACATCCATTGCAATCGCTTATGTGAAAGCGCTTCAGTACTTCGGTGATATACTGT
CACTGCGAGTACACGATCTCGCGTTGCGGGCGGTCGATGAGAATCTCGACTCCAAGTAGGTCCTTCAAAGTTCCCATCGTAGTCAGCTCAAACGTTTCCT
GCAGAGAGGCAGCGATCTCCAGGCACTTCTCACGGGGGTCCATCAGCAGAAGGTCGTCCACGTACACTGTCAGCAGGAGTTTTACTTCACCGTTGACCTT
CAGCACTTAGAGTCTGTAGTCAGAGTCCAGCCGTTCGAACCCCAGTGTCAACAGCTTTGCATGTAGTGTACGGTTCCAGATGTTTGGAGCTTGCTTCAAA
CCGTATAGGCTCTTCAGTAGCTCGCATACCAATCCAGGTCCGTCCACTCGGAAGCCGGGCGTTTGTTCTATGAAGATCAGCTCGTCTAGGGCTCTGTACA
AGAAGGACGTTTTGACATCATACTGCAAAACTTCCCAGCCACGCTGCACCGCGTAGTAGTTAGCTGCTCGGATCGTCTCGAAACGAATGACGGGGGCGTA
CGTCTCCGTGTAGTTCACACCCAGCTCCTGCTTGAAGCCGTGGATCACAACTCTGGCCTTAAACCGTTTTGTACGTCCTCGCTCGTCTCGCTTCACCGCG
AAGACCCATCTGCAGGTGATGACCTTGGACGTCTTCGCCTTCGCACGCACCACTAGGCGCCGAATCTTGTGATCTCTCAGATATTTCAGCTCTGCCAGCA
TGGCTGCCCGCCATTGAGACCAATACTTGCTTGCCCTAGCCTGCTTGTAGGTATTCGGGATGTCGATGTCCACGCCGGTAGCTCGCACATGACCCACCAC
ATAGTCCAGCAGCCGCACGTTCAGGTTCTGCGCTCGCCGTGGCCGCTTGATGCATGGCTCGACCGGAGGGGGCAATATTTTAAAGCCTGTCGTCTCCTTC
TCCTCCACAATTTCTTGCGCGCTTTGCACTTCCGTCGCTTACGAATTTTGGTAGCCGCAGGTGGCTCCTCAGTCTGCGGAACTTGCTGTGAGGTCGGCAA
TGCTGTACCATCCGCAGCATCCAATCCACTTCCATCTAGCGACTCTGGTCTGTCACTGGATCTCAGCATGTTCTCCTGTGGTTCACCGGCGATAGAAACA
ATCTGCACCCGCTTCTCCTGCACAGCAGCTGTCGTGTCCCAACCAGGTAGATACGTTTCCAAACTCGTCCGGATCCTTGCTACAGGCACGGTATCGGGCA
GCGCATGCGCACCATCCATGAACGCATTCTCCAGCAGGTGCTTCATGTAAGTTCCATCGGTCGTAAACTCCTCGTGGAGCCGCACGTTCTGGCGGCGTGT
AGTCACAACTTGTGCTGTTTTTAGATCGATGAACTTGTAGCCGAGGGTAGATTCGCTGTAACCGAGAAGCATGCACAAACGAGCTCGCAGCTCCAACTTC
TCTTTCCGCTGGCGCGACTCCGGAGGGATACGCACGTACGCCAGACACCCCAAAGTCCTCAGGTCCTCCAAATCCGGTTCGTTCTGGAACAGCTTGCGGT
GCGGCGACACAAGACCCAAGGATCAAGTCGGTAACCAGTTCAACGTAGTAGTCATCATGTGCAGGAATGCTTCTCCCCATAGGATGGTTGGCATCTGCGT
AGACGCCAGTATAGCTCGCACCCGAGGCAGGAATACACCATTCGCACGCTCATTCACGCCATTCTCTTGTGGAGAGTATACGTCGGTGGTCCGTTGTTCA
ATCCCATTCTCGTCGCAGTATGCCTTCAGAGGCTTGGTCAGGAATTCGCCACCTTGGTCAGACAACAGTAGCTGAACCTTCAACTTGCGAAAGCGTGTAC
GCGACCGATTCAGCAAGACCTTGATGTGAAAGGTGGCTTCGCTCTTCTCCTTCAGTAGGAAGGTCCACTTATACCTCGTGCATTCATCGATCACACACAG
GAATGTGATGGATCCCTCCACCGTCTCTTCATTGATGGTGCACACATCCATCATGAGAGTCTCAAGCGGTCCAGACTTCCGCACTGGAATCCGGGCGTGA
TGCATTCTCTTCGCCTTGCTAGCAGCACACGCAACGCACTCGTAAGGTGTCAAGCCGTTTAATTAACTCCAACATCCAGCTTTTTCGAGAGAGTTTGCGC
TGAATCCATGCCCAGGTGACCAAAGCGTTGGTGCAGCAACTCCATGGCCTTCTTGCTGTCCATGCGCTGCTTCAACGCAGCCATCACCATCACCCCGGTC
ACTCGTTCAGCACGCAGGTGATAGATGTTCTCCCGCATCATGAACTTCAGCGTTGTACCCGGATTAGAAAGCCAAGCGATCTGCTGGTCTGGTGAACACG
TCAACTTGTACTTGCCCGTGGTCTGCAGGTAGCCCAGACTAATGATATTGACCTTGGCGTTCGCCGTATACACCACGTTCTCCAGCAGCCGATCCTCCAG
CTCTCCAGTAGCCTGGTTCGCAATACGCAGTAGGACAGACCCACAAATCGTTGTGTGTTCAGTTGTACCATTCGCGAAGTCAAGCCGACTAGTTTTGTCT
TCTCTAATGGTTGTGAACAATGACAGGTCTCTACAGACGTTTGCCTGGGATCCCGAATCAAGTATCCACTCCACTGAGCTCACATCACTAGCGTCATGCA
TACCTTGATTGTGCTCTACAGCATTCACCTGTCGAGGTTCACTTGGGTGCGCAGCACCATGCTGTTGCATGCTGTTGCTGATCAAAGCGAGGAGACGAGA
GCTGGGGTCGGCGATCCCACCCACCACGGGGTGGTTGCGATGCATTGTTACCGCCAGACTGTGGTGGAGCACCACGACCATTCCAGGGACCATCCCGCCA
CGGCTCACGCGGCAGCATCGGCGGCGCCCCACTACGCTCAACTGGGTACCCTCGCCACGGCTGGTGCAGCGACGGTTGCCCAAAGTTTCCTGGTGGTCCA
CGCGGTGGCGAACCACCACGCCATCCAGCAAGTGGCAGTTCATCTCGACTCGCTCCCCGCAATGGAGTTCCGAAGCGCCCGCGGGTTTGCGACCTACTAC
GCCAACGCTGGGATGGAGAGTCAGCACGCCAGTTCCTTGGTGGCGATCTGCTGCGCCAATGCCGTGGTGGCGACCGACTGCGTCCGCGTCCACGCACTGG
TGATCGGTTGCGTCCACGTCAACACACTGGTGATCGTTGACTTTCACAACGCTCAACACGAGAGTCCACATTGTCGTCCCCCGGCACAGGATGACCCCCT
CGTGGTCTATCCTCCTTGCGCCATAGCTCGGACGTGGCTCCCTGCAGGCTTTGCTTCAGTCCCTGTCCAACTTGGAGCAGTAGATTTTCCCATGTAGGAG
GGCTCGGACGTGGCTCCCTGCAGGTTTTGCTTCAGTCCCTGTCCAACTTGGAGCAGTAGATTTTCCCATGTAGGAGCCCCTTCTCCCACTGGCGCTGCAC
TCGCCTTGCCCT