Description :
From Genome Similarity Track
Location :
Scaffold_1389:4284- 5936
Transcript NameFunction/comments
Phyta_totarag12858hypothetical protein

Sequence
1652 bases(100 bases per row)
GAGCTACCTGGAGTTTGAAGAACGTCACCTCCGGCCGTTGTGGGAATCGCTCCACTTCTTGCCGATCACAGGGGCGATGTGCCAGGCGGACCCTGACTTG
GTGGCGTATCACGAAGCTTGTCGTTAGCGCAGAAGTCGCGCTGGCGTGGCGTGAACGAAATTCCATCACTAAGTCTTGCAGGTGATGCGCCTTCGTCGGT
GTGATCTTGATATCCTGCTGGATCCTTTCTTCCTTCATCTCCCCAAGTCGTGGGCCCCGATCAGGTGGTTCCCCCGGTTGGAGGGACATGCCGCTACCTT
GATCGATGCTTTGGAGATCGTCGATCATGATGATCTGTGGCTCAACCAATTTTGTGACTACCCTGACGATCATCCTGCGAAGCAGATTAACCGTCTTAAG
GATAAGTTCGTGCCACCTCCGCGGCAGTCGTCGTAAGTCGTTCTACACGTCGCAATTCTTCTAATATATTCCGGACTTCGATCTCCATTTCTCTTGATCT
TGATGCTTATGATCTTCTTCCTTATCCACCCGATCTTGATACTGTCCCACGAGTCTTTTTCATTGTCATATAATGCCTTTGGGCGCACGAGCGCACGTCC
TTTGATCTTGAACAGTCTGAGTCATCGACCCAAATCCAGGTAGTTGGGTCAACCGGTAAGTAGTTGACCCGAATCGAGACCATCTCATTCACGACCTCCC
GTCCCTcctgccccccccccccccccacacacacacagaTCCTTCTTCCAACTCTTCGCAGAGTGGCCCGTCCACCTGCGATATCGCGACCTTACTGCTG
CTCATGAGACTGCATGACGCCGAACCGGTTGCGGTTGGACTGCTCGCACAGAGAGTCATACAGCAATGCTCCACAGTTGAGATCAGCCTTATCAACCCAC
GTGAGCTCCTTATAGCCTTTCCAGTGTACCAAAACTTCTCGCCGCATTCACCCATACCGCgtacgacgacgaacgcATATACATAATCGTGTCCACCTCG
AATTCGTCGTCCTCTAGCTCGTTCTTCAACTGTCTTCAGGCAGTAGCGCTTCGTCAAAGTCGAAAAGAGCTTGATATCGGACGGTGAGGTCTACTCGTGG
GCGGTCGGGGAACCGCCGCAGCAATTTCAGCATCGACACGTGCACCACTGGGAACAACCGGTACACTGTCCCAGCTGTCTCGAGTCGAACAGCGTACGCG
TCCACGACCTCCGCCACTCTGAACGGCCCGTGCCACATAAGCGCCAACTTGCGCACGTAACCTTCCTTCACCCTGTCAAGATATAATCAGACTTGAGAGC
CGGCTTAGATCTCATGCGGACGTACGTCGCGGTTGCGTTGGTCAGCTCGATCCTGGATGGCTTCTCGCAATCGGTCGTTCATTTATCCCCGCGCTTGTTG
ATAGTGTCTCTGGATGTGGTACCGCCATCCCCTCGGGTCACGATCTTGGCGACACGTCGATCCCAGTGGTATCATCGCTTCCAGTGTAGATCGCGGGTCC
CAACCATGAGCCAGATAGAAAGGTGTATCTCCGCGCACTCAATCTTGAGCggtgttgatggcgaacgTCAGGCGTTCCGCGTACTTGTCCCAGACCTTAT
GGGCTACGTCTGTGACGTACACCTTTAACGTCCGAGTTAGTGTCTGCACCAT