Description :
From Genome Similarity Track
Location :
contig_3:42839- 44717
Transcript NameFunction/comments
g884.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
CTGGACCGTCGACTGAGGCTCCTCCCTCGCCCCATGACCGACGTGCTGTCGACCGAGTCCCCCACGCCGTACCCGACGACTGCCACACCGAAGACTGAGA
AGGCCGCTCTCGCGGGCTTTACCGCCTACAGGATGCGCCGGAGACCTGTCACCGAGCGGCTACTATCAGACACAGCCTGCCGACGACGCCAGCCACCCGA
TCAATCAAGCTCGAAGCGGACCACAAGCTTTTGTACTTGCGACAAGATGGCTCTCTCCTAATGGCGCCCTCTTTCGGCACGAAGTACGTGGCCATACCCT
CCTGGTTCTGCAAAGGTGCACGTGTGCAGCCGTATCCCATTTGGTAGGTTGAAGATATGTGGTTCCACAGGTTCGTTTTGAATTCACGACGCGCGCGTAC
TTTCTCGGTTTTCCCGCCCTCAAGCCTCTGGGCTAGCAAATACCTGGCATTTACCAACTGGAGCATCGGAGCGGCAACGGAATCTTCGACTGAACCATGA
CGATCGACAGGTTCTACGGCAAAAAATTGACGAACAAGCACTCGCAGACCGTGGCGGCGCTCAAGCAGAAGGTGGCCGAGCTGAAGCGGGACAAGGCGGC
GCTCTCGCAGGACAACGCGGAGTTGCGCAACGCGCTGCTGGCCAAGGATGAGCAGACGGCCGAGCTGCAGCGCAAGATGGAGACACAGGCCGACCAGGCG
TCGACCCACAAGAAAGACATGGACGCAGTCGCCCGTCTGGAGCAGAAGGTGGCCGCGCTCTCGCAGCAGAACGAGCTGCTGGCCGAGGAGCTGCGTGCGA
GCAAGCAGCAGCAGCAGACGGTGGGCAATCTGACGATGGACGACCTGAAGCTCGAGATCGAGCTACACGCCACAGCCGCAGAGAGCTGCCGGGCGGAGGC
CTACGAGGCTTGGATCCTCCAGCGCCGCCTACAGAAGACACAGGACGAGTGTGCCAGGCGCGAGAAGGCCAGGAGTGCGGACTGGGCCAGACACACCGAG
GAGCTGGCAGAGGCCAAGGCCGACAGCGACGCCTTCGAGCAGATGCTGGTGGTCCTGATCCAGGAGAAGAAGGAGATGGAGACGCGCTACAAGAGGAAGC
TGCACAACAAAAGAGTCCAGATTAAAGGCATGGCACAGGACGCGGTGGAGCTGCATACGCAACTGGTGACGCTGGAGTTGGAGCTGGAGAAGAGGCAGAG
TGAGGAGACCAGCAGCGTCAGCAGTCCCACGACGGTGAGCTCGTGGAGTTCGACTGGGACGACGGCGGAGGTGGTGCCGGCGCAGACGCGTATCCGGCAG
CGGGAGGAGGAGGCCAGCGACAGCGACGGCATCGTGCCTAAGAGGCGTCGGATGGACAGCAACGCCATCGCATTCGACAACCTGCGACTAGTTCGGTGAA
AGCTGGAGTCGTGCATGGCGGATGGTGCAGCAGAGGCACTCATTTCTGCCTCTTCTCGTGGACGTTTCAGCTCTCCGTGGTCTGGAAGCTGCACGACGTG
GGACTCATTTCTCCCGCATGGCAGCTCTCCAGTTGGCGAGACAGAGGCTCATTTCTCTCTGTCGTGCGGTGGTCTGTGGCTACTCGCTCGTTGAAGGTTT
CTGGACGTGGAGTGTCGAGACTTGGTAGGCCTTACGTGAAGTTGCGCCAGCAGGCTCAGTCGATCGGGGCTCATTACCTCCGTTGAAGCTGTAGATGCTG
GCGTGCTTCGCGTGAGGTGCGGGTGTGGTGTGCTTCTGCAGTGGTCGACAGGGACTCATTACTCTCTGTTGGCCACTTTGATTGCTCACTCGCTTGCTGT
TCTACTTTGCTTCAATGCCTGCGTCCGGGGCTTTCTTCGTGTGAGGTGCCTGGATTCCGCTCGCCGAATGGACTTGCC