Description :
From Genome Similarity Track
Location :
contig_3:42830- 44708
Transcript NameFunction/comments
g815.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
ACTCCGATGACGGCTGGACCGTCGACTGAGGCTCCTCCCTCGCCCCATGACCGACGTGCTGTCGACCGAGTCCCCCACGCCGTACCCGACGACTGCCACA
CCGAAGACTGAGAAGGCCGCTCTCGCGGGCTTTACCGCCTACAGGATGCGCCGGAGACCTGTCACCGAGCGGCTACTATCAGACACAGCCTGCCGACGAC
GCCAGCCACCCGATCAATCAAGCTCGAAGCGGACCACAAGCTTTTGTACTTGCGACAAGATGGCTCTCTCCTAATGGCGCCCTCTTTCGGCACGAAGTAC
GTGGCCATACCCTCCTGGTTCTGCAAAGGTGCACGTGTGCAGCCGTATCCCATTTGGTAGGTTGAAGATATGTGGTTCCACAGGTTGGTTTTGAATTCAC
GACGCGCGCGTACTTTCTCGGTTTTCCCGCCCTCAAGCCTCTGGGCTAGCAAATACCTGGCATTTACCAACTGGAGCATCGGAGCGGCAACGGAATCTTC
GACTGAACCATGACGATCGACAGGTTCTACGGCAAAAAATTGACGAACAAGCACTCGCAGACCGTGGCGGCGCTCAAGAAGAAGGTGGCCGAGCTGAAGC
GGGACAAGGCGGCGCTCTCGCAGGACAACGCGGAGCTGCGCAACGCGCTGCTGGCCAAGGACGAGCAGATGGCCGAGCTGCAGCGCAAGATGGAGACACA
GGCCGACCAGGCGTCGACCCACAAGAAAGACATGGACGCAGTCGCCCGTCTGGAGCAGAAGGTGGCTGCGCTCTCGCAGCAGAACGAGCTGCTGGCCGAG
GAGCTGCGTGCGAGCAAGCAGCAGCAGCAGACGGTGGGCAATCTGACGATGGACGACCTGAAGCTCGAGATCGAGCTACACGCCACGGCCGCAGAGAGCT
GCCGGGCGGAGGCCTACGAGGCTTGGATCCTCCAGCGCCGCCTACAGAAGACACAGGACGAGTGTGCCAGGCGCGAGAAGGCCAGGAGTGCGGACTGGGC
CAGACACACCGAGGAGCTGGCAGAGGCCAAGGCCGACAGCGACGCCTTCGAGCAGATGCTGGTGGTCCTGATCCAGGAGAAGAAGGAGATGGAGACGCGC
TACAAGAGGAAGCTGCACAACAAAAGAGTCCAGATTAAAGGCATGGCACAGGACGCGGTGGAGCTGCATACGCAACTGGTGACGCTGGAGTTGGAGCTGG
AGAAGAGGCAGAGTGAGGAGACCAGCAGCGTCAGCAGTCCCACGACGGTGAGCTCGTGGAGTTCGACTGGGACGACGGCGGAGGTGGTGCCGGCGCAGAC
GCGTATCCGGCAGCGGGAGGAGGAGGCCAGCGACAGCGACGGCATCGTGCCTAAGAGGCGTCGGATGGACAGCAACGCTATCGCATTCGAGAACCTGCGA
CTAGTTCGGTGAAAGCTGGACTCGTGCATGGCGGATGGTGCAGCAGAGGCACTCATTTCTGCCTCTTCTCGTGGACGTTTCAGCTCTCCGTGGTCTGGAA
GCTGCACGACGTGGGACTCATTTCTCCCGCATGGCAGCTCTCTAGTTGGCGAGGCAGAGGCTCATTTCTCTCTGTCGTGCGGTGGTCTGTGGCTACTCGC
TCGTTGAAGGTTTCTGGACGTGGAGTGTCGAGACTTGGTAGGCCTTACGTGAAGTTGCGCCAGCAGGCTCAGTCGATCGGGGCTCATTACCTCCGTTGAA
GCTGTAGATGCTGGCGTGCTTCGCGTGAGGTGCGGGTGTGGTGTGCTTCTGCAGTGGTCGACAGGGACTCATTACTCTCTGTTGGCCACTTTGATTGCTC
ACTCGCTTGCTGTTCTACTTTGCTTCAATGCCTGCGTCCGGGGCTTTCTTCGTGTGAGGTGCCTGGATTCCGCTCGCC