Description :
From Genome Similarity Track
Location :
Scaffold_46:428296- 437593
Transcript NameFunction/comments
Physo_136565predicted protein
Physo_136566hypothetical protein
Physo_136567hypothetical protein
Physo_136568hypothetical protein

Sequence
9297 bases(100 bases per row)
AGAGAGTCGACTCTGTTTCCGAAAAGTCGGTGACTGAGACCAAGGCCCCTGAAGATGAATCGAACTCGTCAGAAGATGTTACCTCGGCTGTATCATCGTC
GATCCATGCCCGCTTTTTGGGTTTTCATGAACGTCTTCGCGACTTTGCAGACGAGTGCCTTGCGGTGCTGGTTATCGGTGGGTTGGCCAACATCCAGTTC
ATTCCGAACGCTCTGATGTTCGTGTTCTTCGCACTCACTACAAACTTGAGCCCGGCTGGTGTCGCGTTTTACGGCGTGGTAGCTACTGGAATGGAGTTTT
TCATGGTGATATCTCGCTCAATCGCGACGCACTTGTACTTGAAGGATTCGCACAACGGTCTGCGGAAGGAAGTGAACCGCTACCATGTCAAGTACGTGTT
GCCCCAGGTTGTCACGGGCTGCCTTCCGGCTGTAGCCACGTACCGCCACTACATCGACGACAACGACGCGTTTGTTTCCGTGCTGCTGCTTACAGCCTTC
GTGTACATTTACGAATTCACGTACCGTGGCAATCCCCAACAAACCGGGTGTCGGGAGCGCATAAGCTGGGTCACGGGTCGCAGCATGCTGATCGACACGG
TCAAGCGCTACTTCAGTGGAACAATCATTCGGATGGCACCCCTCGACCCGGAGAAGCAGTATGTGCTGAGCTTCCACCCCCACGGAATCATGCCGATCTC
GGTCATGTGGCTCCAGTTCACGGCGCAATGGCGAAAGCTGTTCCCGAACTTCTACGCGCACATTTTAACGGCGAGCATCCTGCATCAAATTCCGCTCGCC
CGCGATGTGCTCCACTTCTACGGGTCGCGTGAAGTCTCCCGACAAGCGTTCGCGTATACACTCAAGCAGAAGGAAAGCGTGCTGCTTGTGCCCGGTGGTC
AGGCGGAGATGCTGGAGCAACAGTCTGCGAAGAAAGAGGTGCGCGTGTACACCCGCCACAAGGGCTTCATCCGTCTTGCCATCGAGCACGGTGTGCCGCT
GGTGCCCGTGCTTAGCTTCAAAGAGGGCGAGATGATGGACAATGTCCAGGCGCCGATGCTGCAGCGCTGGTTCGTCAAGAAGCTCGCGTTCCCGTTCCCG
TACTTCCCGTACGGCCGCGCTCTGCTGCCGATCCCGCGTAAGATCGATATTCCGGTTGTAGTGGGGGAGCCATTGGAGGTGCCGCATATCGAGAAGCCCA
CTCAAGAGGATATCGACAAGGTGCACGCCAGATACTTTGCTGCCCTTCAGGAAATGTTTGACAAGTATAAGGATGAAGTCGGCTGCGGGGACTACAAACT
CGTCCTCCTTTGAAGAAAGCGCCCTCGCTAGTTGTTAGGCCCATTGTAGGAAAGAAAAAACATAATACCATCCATCCGCTTCATACTAAACGAGCCTCAA
GAACTTTGCAGTGCGCTTTGGAGCGAGCCAAGCGCAGTCTCGATAGTGCAGCTCCCTAGTATGATGTGTTCCGGAGCAAGTTGATGGGTGTCGCCAGAAT
TTGAGCATCTCGTCGACCGTGAAAATGCTGTGAAATGATACCCTCAAAAGGCGGCTACATTACTACCGAAGTAGGCGAGGTTCGTACTTCGACGCGGGGT
ACGGTGAGTGAAGTCAATAAATTGGGCGTCCTAACATGTGCGCTTCACTAGTGTCGTGTGGTCGCAAAGGAATACATGCGCGTCCCCAATCTAATTCTCG
TTGAAACTGCTCGACATAGTGCTGCCAAATGGTGGGTGGACGGTATGTATGTTGTATGCAGCATTTCCTGCTTTGGACCGACTTCGGTTGTCCTTGAAGT
CAGTCGAAACCACCAGCTGTACTAACGAATGCAGTGCTCTCATTGCTCTCATTGCTCCACTTGCCGTCCAGAGCACGAGTAGCTCAAGTCAAGAAGAGTT
CCGTCGTCTGCAGACACCAATGCCATCGCCGCGACAACGGCACCGCAAGCCCCAGACGCTTCCGCCTCCTGTCCCTCACATCGAGGATACAGACTCTGCG
ACCATCTCGGTCGACCGACTCAATGCTCGAAGCGCGCTCCTGCTCTCGATGGCCGTCACGTCGTTCGCGGCCTTCACGCTCTTCGCCATCGCCGAGCACG
CACCACCACCCGCGCTTCCTGCTGGCCGACGTGCTGCAGGGCGAGACGCACCTCGCCGCGCAGTGGGCGTTGCTGCTGGCCGTGCCCGCCACGAGCGCCG
CCGCGTGGTTCCCGATCTCCATCTCGCACGCGCCGCGCGGCGTGCTGCGCATCCCCCCCCCCCCCCCCCTCGGCGATATTGTAGTGGTCTCCATGTTGAA
GTGGCGGATATGGTTTTTGCCTTTTGGGTCAAGCCATCGAGTTTTCCTGCTTGATCGGTTCCTTCAACTCGCCCACCCACCTTCTCGCCATCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGACGTAGAGTATACTAACCACCACCTCCATCAATCTAATCTCAATCAAAGGCTTAAAGTCGGCAACTTTCATGCTATTAACC
ATGAGATTAGTCTCGGCGTTTGTCTTGGAATTGACGTTGAAGTACGGACAACTTGGCGTCAGACCACGGTGTGCCCGCGTCAGCCTCCGGCTGAGGCAAC
TTCGGGATCTCAAACTTGACACGCGCGCCGTTGCCAATGGCTAAGGCGTCCTGCACCACCGCTGCTACCACGGGCGAAAGACCGTTGTTGGAGGTTTTAG
GCGTTGGCAGTCGCGAGTCGGAGCTGCTGGTTCCTAGCGGCGGCTTTTTGGAGAACTTCGCCACGGATGTAGCAGAGACCCAGTCGGGAAGCCCAGCGAG
GACGCCCGAGTCGCTCGCCATCTGCCACTTCATACGCAGCGAGCACAGCTCCGCCGAGAGCTGTTTGTTCTCTTTGCGTGCGTTTGATCGCGTCCAGTCC
AGTTTGTTGCGCACGTCGATGAACTTCTCGTCCATTAGACGGAGCTGGTCCTCCAGGATTCGCGCGCCCTGCTCCAGCTCCGCCACCTTTGCGTCCTGAG
CGACATGCTTGCGAGTTGCAGTGGCTAACTTGTCCTTTGCGTCGAGTAACTCCTTGTCCACACGACGTTGAGCTTCCACTGCGCGTGTTTTGGCCGCCGC
TTCGTGCTTCAGATGCACCATGAGCTTCTCCACGTGCTCCGAGAGAGCGGCGACCTTCTCGCCCAGCTCCTTGTTGGCCAGCTCGCTCTTGGCACGCAGC
TCCTTCTCGACTCGCTCACGACCGACCATCTCCACGACTTTTTCTCGCATGCTTTGCAGGTCTCGCAGGCCAGCTTGAGCCGTGTCGAGCTCGCTTTCGA
GTCGTTCAGTGCGTTCGATCAGCCGCTTGTTGCGGCTTCGTAGCACTCGCATCTCACGCTCCAACCGTCCAGCGCCACCAAGGCCGAGAGCGTCCAGGGC
TGAGAAGTTGTCGACGTTGGGTAAATGGCACGACGATGCCTCGCCTTCGTCTGTCGCGGGGTCAAGAGACGACGAAGAAGACGCCATTGGACCTCCAGCG
AGCTGTCCACTCATGCTCCAACGCCTTCAGTCGCAGACGCACCAGCTCCTCGAGCTTCACGTGCTGGTACAGCATGTCATCGACGCTCGAGTCATGACTA
CCGGTGGCGATCGTCGGATCCAAGCCAATCCCGCGAAGCAGCGTGCGACGCACTCCTCCCACCTCCTCTCTAAGCTGAGCCAGCTCGCTCTTCGTCTTGT
CAAGCAGTTCGGCGACGCGGAGATGTTTCTCGCCTTGCTGGACGAGCTGCTCACACTTGGCGAAAACCTCCTGCTGAAGCCCCTTGACCCGCAAGGCAAA
GTCATTCGAACCGCTTGTGAGCGAGAGCAGTGCCAGTTCATCCTCCAGCGCCTTCACTCGAGCATTGGCTTCATCCAGCTGTGCCTGCTTCTCTTGAGTC
TGCTGCTCGGCACGACGCAGCAGCGCGTTCTGGTTGTTCCGGGTTCTGGTTTAGGCTTTTACGTAAGTAGTTGCCGGTAGTCTTACAGGGCTTTTGCTTA
TCTCCTGACACGGTTCTTCAAGATGCAGGTTTTATTCCAGCTCGCAAAACTTCAGTTTGCATGCTTTTGTTAATTGCCAACAACTGTGCCGACAAACTTA
CTTATTGAGCCTATTAACCTGTGCAAACCGCGTACTCGGTATCAACCTCAACATCCAGCTTCATGACTTTGAAATGTGAACGCATTGCCTTGTAGTCGAT
GAATCCTCCGCTAGGTTCCATCCTCTTCCTCAAAATTTCTTCGGCGGCTTTGTCAACATGTTCCTCACTGCCTTTAAGCACCGACTTGAGAGCTGTTTTG
TTGGCTGAATTCATTGGGACGATAGGTGTACATGCTGGATGATACGCCAATGTTCCATGGAACCGCTCCGTCTCGTCTCGGGTCAAGAGGAAGCAATCAC
TCGGCACAACATAGTCCTCAAGATTTGACGGGGCAACACAATTCATGACCCCTCCCACCAAACGCGTGCCTTTCTCGAGAAATGCAGGGCGGGATTTCCT
CAGCTTGCGAAGATACTCCCTTGCTGATTTTGGCTGAAATTTACCGAAATGCCGTTTTCTTTGGTCCACAAAGACAATCAAATTCTCAGAGAGAGCATCC
TTCAGAGCAAAGAAAATATCGACGCCAGCTCCACCAACCCCATTCACAATGATGTTGCCACTTGACGTCCAGTCGGCTTTTTCCGCTAGATGGTCTTTTC
GTGAAACGACTTTGGGAGTTGAAGAACCATATTTTTCCGCACACTCAAACACTCTTGACGGAGCAAGTTTCACGGAAATGCGACGCGTGTCATCGCTCAT
CAGCGCCCCCGGCAGAAGCTCTCCCAGCGTCACAGTCGAGCGCCCAAGCACCAGCAAGGCATTGATTCGAGCAGCATAGAAACAAGCACCGAACATCTCC
CACGACTGCCACGGCTCACGGACGAACAGTTCCGAATCCACCAGTTCTTCAATGTCACTTAAAGCTGCTGCAAAAAAAATTTCTGCTTTGCTCGTCATAT
CATCACTCGACGCGATACTCTGCAACAGCGCGTAGGGAACCCGTACATCGCAAACTCTAGGTGTGGATGATGATGGGTTGAGCACGCATATCGAGGAATC
TCGAAGTTTGGACCACTTGAACTGTTTATCGAACGCGTCTTGGTGTCGAACCTGTCGACCCGACACGGCATAGGCTGCCAAACGGACGAGCTGATGGGTT
GATATTAACCCCGTGTAAGCATCGACGTAGGTTGTCCAGACGCCCTCGAAGCACATTTTGATGCTCTTCAATGTAATTGTATCTGGTTCCGAGCACCTCT
TCAGTCCCAATAGGTAATCGACAACCCACCGTGGAACACCTCCAAGAGCGAACAAATGGCGATAGACCTGAGTATGTCGCAAGAACCCAGCAAAATTTGC
ATTGCTCTCCACAGAGGTGAGCACTTGCCCCAGGGTCAAGAGGGTCATGGGAAGCCGCTTGGTCACATAATACGAGGAATTGGCGATTGAATCCGGTGCA
ATGACGCCCAAATCCGTCCCTGCAAACATGGGCAACACAACCAGACTTGACATCTTCGTGCACAGGAAATGTGCTATGGTTTCCACGAGTTCGCGCAGGA
TTGACGTGCCGGCATTTGCTCCAGAGGTCCTTAGTTTTTCAATCTTTTGGTAGTCATCGATGCCAACAAAGATGCACTGCATCCTTTGTACTTGCACGCT
CTGACGCAACTTGCGCTCGATAATTTTAATGCAGTTACGAAAAGTCAGCTGACTTCCATTACAAGGTAGCCGTGACTCGAACCACGTGACGAAATCAAAC
GCGCAGTTATTGTCCAGAAAAAAACGATACAAAAGCCGCCACGAGAAAGACGCCTCAATCGGCATCGACCGCTCGACTGGTATTGGCTTATATCCATTGT
AGTACGGAACAATCAGGCGAATAACGTACTTGGGGTCCACTTTCATCTCTTCAAGAATCGTGCCACTTTCCTCCAGCATACGCGTTTTCCCCAAACCCGA
AATTCCAGAGCAAACAGGTATAGGACGGTGTGTGCGGTCTGAGCCTGTACCACGATTAGCCTCGATGATTCGGTTGAAGCAATCCGCTGCGGTCTTAATT
GCCTCTTCTCTTCCAACCAATCGAAACTGTAAACTTTCGGCACCTAAAATGTTACGGTTTACCACAATTTCTTCCTTGTTGGCCATTTCACTTTCCAGGA
ACGCGAGGAGATCATCACACGAAGTCGTATCCACAGCACGTCCCTTCGGCACATCCACCCTGTCGTGCTCGACATCTCCCCCCTTCGGAAGCACCACCAG
CACGTGAACCGGGGTCCGGTAAGACTCGACCATGTCTATCGTGATTTCGACCAGCACGCTCGTCTCCGTCAATCCATACAACTTGAGCGGTGCCCCCGCA
GCTTTTAGAAGCGTCAATCCAGCCGTACCCACCCTGTTCTCCACGTCTGCCTCAGTCAGCCACTCGCGCTCCCTCTTCGCCAAAAAGAGCTGCAGCTTGT
CTGCGTCGATGTCCTTGAGGTCGTTCGTCTTCTCCTTCTTGATCGCCTTCTTCAAGTCGTCCACCGTGTCGCTCTCGTCCGCTCGCACCGAGAACGCGGG
GCCTGCCCCACCATCGATCGCGCAGAAGAGCTTCATCTTCCCTCGAGGCGGCAAGTTCTGGGATGAAGAAAGGGAAGAGAACTCGCCATCGTACCTAAAC
GGGATCTGCCCTTCCGGAATGTATTTTCGGCCAATAAAACTCGTTGTCAAATTGATTGTTGACGACTCAGCTGAGCCCACGTCGTCGGTGCCGCCGCCGT
CGCCCGACTCCCCGGCGCTGTCGTTGTCTCCGTCGTCGTCGCTGCTGGCCAAGCTGGCGAGGCGCTACCGCCGCAATCACATGTTCGCCATCTACCAGAG
CGTGGGCTGGACGCTGTACGCGCTGTTCGTGGCGCTGCAGCTCGTGTGCTTCGGGTCCGACGGCGTGCGCGGTCTGCCGTTCTGCCGACCGGGGAGCCGC
TCGGTGCAGGCGGTGGCGGCGTTCATCGCCGAGGTGCTCATCATCTCGTCGGTGCTGACGCTCGAGAAGCGTCGGGACCGCAACCGTCAGCGTCGGAAGG
ACCGGTTCGTGGTGCAGCTGAACAACTTCAACAACATGCTGCTGCTGGTGGGCGCGACGCTGTTGGCTTTGGCGTCCGAGTACACGCGCATGTTCCCGCA
TCCATCGGGCAGCAGCGTGGGGTATCCGATGGCGACGGGACTGGGTTCACTTGCGCTATTCGTGACAGCGCTCTTCAACACGTACGGTCTGGGCGGTGTG
CTATCCACGAAGGACGGCTGGAACTTCTATCAGCCGGTCATGGCTTCGTATTGTTCCAGATCGTGTCGTGGTCCTGCTTCGCCGCTGGAATAGGGTTGCA
ATTGCTGTACTTGCTCTCGTTGGTGGTTGTGGAGCTGGAGCTGTTCGTGGGGATCATGGCCGTGGCAGGGTTCCTGTTCGTGGTGGCGGAGATCGACATG
ATGGTGTCGTTGCTGGTGTTCAGGAAGTCTTCAGGTGGTGCCGGTCGTGGTTCTGAGCTTTTGAATGAGGCAGACGCCTGCATTGATGACGATGAACAGG
CTGCAGCGAAGTCATCACACTTCCACAAGCGCCTGCATCGATTCGCTGGTGACTGCCGTGGAGTACTGGTTATCGGGGGACTGGTCAACAACTTTCTCAT
CCCGAACGCCACAGTATTCTTGCTTTTCGCGATAACAACGAACTTGGGTCGGTACGATGTGGCTCTGTACGGCTTTTTGGCGTGGGCCGTCGAGGCAGCG
ATGATGACAGCTCGCTCAATCTCGACCGTCCTGTACTTGAAAGACTCCCACAATGGTCTGCGGAAGGAGGTGAATCGATGGGATGTCAAGTATGTGCTGC
CCCAGATCGTCACGGGCTGCCTTCCAGCTGTAGCCACGTATCGCCACTACATTTACGACATGGAGGCGTTCGTCCCTGTACTTATTGTCTCAATCGCAGC
ATACTGCTACGAGTTCACGTTCTTTGGCGACCCGCAAGAAACGGGATGTCGCCAACGCGCTAGCTGGATGAACGGGCACAGCTTTCTCATCGAGACTACC
AAGCGATACTTCAGTGGGAACATCATTCGGATGGCACCTTTGGACCCGAAGAAGCAGTACGTCTTGGGCTTCCACCCTCACGGAATAACCCCCATTTCGG
TCATGTGGCTTCAGTTCAACGCACAATGGCGAAAACTGTTCCCGAACTTCTACGCGCACATTCTGACGGCCAGTGTCATGCACAAGCTGCCTCTTTCGCG
AGACCTTCTTCAGTTTTTGGGCTCGCGCGAGGTTTCTCGACAAGCTTTCACGTACACATTACAACAGAAGGAAAGCGTGCTGATCGTACCCGGTGGCCAA
GCCGAAATGCTGGAGCAACATTCAGGCAGGAACGAGGTGCGCGTCTACACTCATCACAAGGGTTTCATTCGCCTCGCCATCCAGCACGGAGCGCCTTTGG
TCCCTGTTCTCAGCTTCAACGAGGGCGAGATGCTGGATAACGTCGAAGCGCCGGCGCTACAGCGATGGTCCGTGAAGAAGTTCGCGGTCCCGTTCCCGTT
CTTCCCGTACGGCCGTGGTCTGCTACCGATTCCACGCAAAGTGCACATTCCTATCGTGGTAGGCGAGCCTCTTGAAGTGCCGCATATCCCGAATCCTTCA
AAGGAGGACATTGAAAAGGTGCACAGCAAATACTTTGCAGCACTTGAGCAAATGTTCGAGAGATACAAAGACGAAGTCGGTTGTGGTGACTACAAGATTG
TCTTCATATAGAGACACCACAGACAAATTTTACAAGCAAAAATGACATTACCCCACTTGCCTTTGTCCCGCCCAGCTTTAGTGCAGCCTGCGGATTCCTG
CCACCCTTGTCTACGGTTTGAACAGGCCAGCAAGAGCTTCAAAGCGACCGCGACGGTGGGTCTGTTCTGGGAATTGCTTCCACGCTGCCTCCACCTTGCC
CAACACCTTTGAGAGGTCCGACGGCACGGGCCGTTTGAACTGCTCTTCGTATTGGTGCCAGATGTTGGGAGGCACGAGCGCTGCATACGCGAGCAGGATG
CAAGCTCGCCACTTGCTCAGGCTCTTTTCCCATGAAGCAAAGATCGTCTTATCCCCCGGAGCCTCGCAAGCGCGTCCAGAAACTTCTTGAACTTCTT