Description :
From Genome Similarity Track
Location :
Scaffold_27:42826- 43835
Transcript NameFunction/comments
Physo_133599COG1840: ABC-type Fe3+ transport system, periplasmic component

Sequence
1009 bases(100 bases per row)
ATGAAGCTCTTCACCCCCATCACCGCGGTATTCGCGCTGCATGCGCGTTCGCCGTCGAAGACGAGAGCAAAACGCTTGAAGAACTCTACGCCGATGCCAT
CGCCGAAGGAGGAAAAGTCGTCATGTACCACGGAGGAGACTTCAAGTCTCAGCAGGACTCGCTCGAGGAGAAGTTCGAAGATGCCTTCCCCGGAATCAAC
TTCACCATGGTCGTCGACTACAGCAAGTACCACGACGTGCGCATCGACAACCAGCAGGAAACCGACACGCTCGTGCCGGACATCACGGCGCTCCAGACCG
TGCAGAACTTCCCTCGCTAGGCAAAGGCGGGTGATCTGCTGGAGTACAAGCCGGCCAACTTCTCTAAGATCTACGATGGCCTCGTGAACTCGTTCAGCTA
CATCTACGACTCGAGCAACCTCGGCGGGCTGGACGCACCCACGTCTTCGTCAGATCTGGTGAACCCCGAGTGGGCGGGCAAGATCGCTTCATCGTACCCG
CACGACGACGACGCCGTGCTGTTCGTCTAGCAGTACGGCTGGGAGTGGGCTGCCGCAATGGCCAACCAGAGCATCAGCTTCAACCGCGGTTCGCACGTGG
CGAACAACCTGGTCACGGCCCAAGAAAAGGTCATCGGTGTGGGCACCTACGCCGGTGCGTCCCCCATTGTGTACGTGGGCGGCAACGGCACCGAGTACTT
GACGTGGGGCCAGCGTCTCGCTATCCTGGCCAAGGCGAAGAACCCTGTGGCTGCCAAGCTCTTCATGAACTGGATCGTTTCCACGGAGGTGCAGGAGTCC
GTGGTGATGGAGACCGTGCGCACGGACATCGCTCCGTCTGGATCGAGCCACCCGTGGGAGATCCCGGAGGCTAATCTGGACGCCTTCCCAGCGTTTATGG
CGAACCGCACCGCGGCGGAGCAGTGGCGCCAAACGTTTGCCCTGTACTTCGGAGAGGTGCAAGGTGAGCCGACGCCGGGCTACCAGGTGTCCTCCCCGGA
CTGTGAGCG