Description :
From Genome Similarity Track
Location :
Scaffold_47:42820- 44447
Sequence
1627 bases(100 bases per row)
CTGCTTTCTCTGATCTGCCGCAAGAAGCGCCCGTGTCAACAAGCACCCAACAACATTGACCGTCGTCCTCTTGCGTGACATCTTCACGCGCTTTGGTGGC
AAGAGAAGTACTTCCGTGCACACCTCGTGCCGAATCTGCAGCCACGTCTCGGATCCCAGAGTGTCGCCACGCTTCGTGCCGGACGAGTTGAACTTTTCTA
GACGCATGATCATCATGTCGATAGACAGCGGGTACAGACTCGTTGACTTAAAGCCGCTCACGATGTTGTGCTGCTTGTGCTGCACGTGGTCAATGAACGC
CTTGTTGGCGATCTGGATCGCTGTCGCCTTCGANNNNNNNNNNAACGTATAGGTTGTTGTTTTGGTGATCTCGTTTGTGATTCCCCTCTTGAACGGGCGG
AACACAGCGACGTCTAGAGGCTGGACGAGGTGGGTAGCGTTGAGTGGGAGGCACACCAGTAGGATTCGCAGTTGCTCACAACGCTCAAGCGTGTCGAGGT
TAACGTGTGACAAGCAGCCGTCGCATATCAACGCAAGTGGACGCGGTACAGCGTCCAGGACGTTGCACGCAAAATGGGTGATCCACTTGAAAAAGATGCT
GGTGTTTATGAACCCTTTGGGCGCTGTCGTGATGGCGGCTTCCTCGATACTGCACTCGTCCAAAATTGACCGGGATACGCGCATGCTCGGCAAAACGAAG
AGAGGCGGAACAGCAAAGCCGTCTGCGGCAACAGCAGCCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTGGGTACGTTC
AGAGATCCCTTTACAGCTATCACTTTGCGCGTGTTGGTCCTTGATGTGAAGCTCGTCTCGTCCATATTGAGGACTTGCGATGGCTGCAGCCACCACTCAC
TCGTCAGCTTGGTGAGAGTGTGGAAGAGTGTTCGCAAGTCGCCTGCGTCGACAGAATTCCTGGCACGCGACACCTTCTGAGCCGCTCGTGGGATCAAGCC
CGGGTGGCGCTCGCGAAAACGACGATACCAGCCGTCGGTCAAGCCTTTGACAGAGCGCGTGCTGCTGTGGAGACGGTGGTAGATGTCGTTCGCCTTCTTC
AGAATGGCTTCGCGCTCTATTGGCGAGCCATCGCGCTGCATCGCAGCAACCCACACGACGCAATGTCTTCTTCGGTTTCGATCGGCAGTGTTGGCTTGGT
TCTGCGGCGCTGGTCACGCGCGGATTCGTTGTTACGGCGACGCTTTAAATAGCGCTTGAGAGTGATCGCTGGGATGCCAGTATCTCTCGTCACTTCAATT
GTCGTCTCTCCTTCCATCACGCGCGTGACCGCAACGTCTCTTAGCGTTTGTATAGAACTTGCGACGTGCCTTCATGATAAATTGCGAACTGCAGCCGACG
CAAACGCTCTTGCGCCGCCGTGGACTTACTCTCTTTGCGTGTGTGTGCCAGTCGTTGCAGGTCACGATCCGCTGGGGTTTGACCCCAGCGGATCATAAAG
TGATCATATACAAATCAACCAATGAAAACAGAGTATTGACCTGAAAAAAATGAGACGAACTCATTCGCTAAAATTGCGTGTGGATCAGGAACTGGCGACG
GGATCTTATTGTGATGGTTTACGTTAA