Description :
From Genome Similarity Track
Location :
Scaffold_58:42804- 45229
Transcript NameFunction/comments
Hyaar_Emoy2806982hypothetical protein

Sequence
2425 bases(100 bases per row)
GTAGGGAGTGGGACGACTGGGATGTTCAGTATATCAAGCTGAAGGTTGATGGGACTGAAGGTAGAAGCACTTTCTATGAAAGTGGTTTGTCTTGGGTGAG
GCTGTGGGCGTCACGTGAACGGTGTCGCTGTGTGGGTTTTGTTTGTAGACGAGAAAATGGGTCGGGAGGTGCACGACGACAGGATGGCGCAAGCGTTTTG
CAAGACGGTAGTCAGTCACTTGGAGGGCGAGAGAAAAGACATGGACGTGGCTGCGTTTGGGGCCGATGGCTACAACTTTGTGGGATTTCTCATTGTGAGG
TGCGTCATGATAGTGTTGGCGTTGAATGGAGATACTCATGGTGTAAAAAATTGTGGTGCTGACAGCTTTTTGGTCGAACATTGCGGTCTGAACCTTGACG
CTGCGGTTGAAGAGTTCGCGGTCTCGACTCCGCCTGGAATCTACTCGAGGCATTACCTGACGGTGTGTGCGTGTTTGACCGTTGCGGGAGAGCCGGCTGA
TATGATACTAAATTGTGCTGTTCTGGTCTTTTCTATCGGAACGTACTGACACAGCAACTATATCGCAAGTACTTTAGTACGCTGTCGTCTGAGTTGACAC
AACTGATAGTTCCTGCTCCTCCACGATGGGAAAATGAAGAAGTCCGGAAGCGCGAGAGTGAATTACCCATTGGCATTGAGGTTGTAACGGATCAGGATCG
TGAGAACAAGTTTGTGCGAACAGAAAAAGTTGCCATCGTTAGTGCTGTTTCTACGAGAGATGCGCCGGTTGACAGCGGACGGGCAACTACGCCTAGCAGT
GTTCCTGGTGCTCCGGTGTACAAAGCACCTATGTACATTCCACCGGACCGTCAGCAACAGCGTTCGGCGAAACGCCGGAAAGTCCGCTCATGGATAGATG
AAGTGGAACCTCTGACGTATGGTGAGACGCTTGCAACATCATCGGCGGAGCACAAGCAAGCGATTAAGTCGTTAAGGAAGCTTACAGGTGTTGAAGGATT
TCCTGGATGCGAGGTAAGCGGACACTTATTAGTGTAATCGCAGATTATTGGTAACAGCTGCTGATACGTTTAATATGCTCTAGACAATTCCTTTTACAGC
AACGCACGTCGCAGAAGGAGCTTATAAACGCAAGGGTGCTTTGACCAAAGCGTATCTTGTTACGTGGCGAGCACGGGGGTGTGTTACGTGTCATTATGAG
AGGTTTTTGATAGGTTTAACAACTCGTTCTGTATCATAGCCGTCGCTGTCTTCTCTATGTGGCGAGCGTGGGGACCTACGTCGTGTCGCGCGACATGACT
TTTACGAAGGTAAACATGAAGTCCGCGACGAAGAGCAACGGTACGTGCTTGTACGAATCACTACGCCTAGCAGTTTGATGTTCGACCGATGTTCGATCAT
TTACTTTTTTGCCCTTTGTATGCCCTTCATCGCTTTTGAGACAATCATGTATGAGCTTTTACGCGGTCAAAAATAGTGATCTGAATAGAGTTAACAACTC
GTTCTGTATCATAGCCGTCGCTGTCTTCTTCTATGTGGCGAGGCGTGGGGACCTACGTCGTGTCGCGCGACATGACTTTTACGAAGGTAAACATGAAGTT
TCCGCGACGAAGAGCAACGGTACGTGCTTTGTACTGAATCACTGCAACATGGACACAATACTTAGCTGTCTTTTGGCTATGTCGTATGGAATAGAATGAG
TGCCAAGTGAACACGTTGATTGACGGGCTTATTGTAGAAGATCAGGATCATGACACGAAGGTGGCTCGATATCTCGCGTTTGACGTCATTTTTCTGGAAG
GTGTGCCAACTTGGCAGAAAAAATTGGAGAAGCGGTTACAATGTTTACAGAACGAGATTATTGTGCCACGCAAAAATGTACGTTTGGTGTTTGTGTGTAG
ACATCGACTGACAACCAAGTCATCGCTAATTGACACTACCCTGTGATATGCTTGAACAGGACAAGTCGTTTGATTACACGAAGGAACCTTTTCGTGTGCG
TATGAAAGATCACTTTCGTCTTGGCAAGACGGAGTACATGCTGACAAAGTTTGCTAAGAGCGTGACGCACGAGGTGGACGGTGTCATTTACACCCCTTCG
GAGGCTCCGTATAATCTCGGCGGTTTCGAGTGTGAAGAGCCAATTTTTAAGTTCGTTGCTAGCGAAGGCGGAGGCATTCCTGGTTTAGACGGAAGCATTT
CAGAGCAGCGACTGCTTCAGTACATTGACTCTATCCCGAGTTGACTGGATTCAGCGCTGCGCAACACCATTTTTCAGCCATGAAATGGAACAGTGCTCAG
CACTTTAGAGAGTACCTTCCTACGAAAGGCGCGTGTTTCAGGTGTCAGGCCGTGTCTTGATACGAGGAAGCCTGACGTGTGGTGCGTTTTGGACAGGGAA
GAACCATATCAATGCGAATACGGAA