Description :
From Genome Similarity Track
Location :
scaffold_707:4280- 9065
Transcript NameFunction/comments
Pl_102852hypothetical protein PHYSODRAFT_484119
Pl_102853hypothetical protein PHYSODRAFT_450629
Pl_102854hypothetical protein PHYSODRAFT_312329

Sequence
4785 bases(100 bases per row)
ATGTCGCTGCTCCACGGCCGCAGCATCTTCCTGCGGGGCGTGCGACGCCTCGAGGCCGTCCATCGAGCACCCACCTCGTCCTCGTGGTTGGGTCGTCGCC
CTGCATCCTTCGTCCTTCCTGCGTTGGGCAATGGAGCGCTGAGCTTCTCGACGGCGGCACTGGATGATGACAAGAAGAAGAAACAGCAACTGCAGCAGAC
GAAGCCGAAAGCGTTGAACGCGCTGAGCGGCATGGGACTTGACCGCCCGCCCGACACAGCCAAGGAAATTCTGAGCTTCCTTATGGGCCATCTCTGGCCT
AACGAGGACTCCAAGGAGGCCAAGGAGATCAAGCAGAAGGTGCTCATCTCTGCGGGTCTCGTGGTGGCGGCCAAGGCACTGACCATCCAGGTGCCGTTCA
TCTTCAAGGATCTAGTGAATAGTGTGGGTGAAGTCTCCACTGTGTTGGCGGGTTCGCCAGAGATCACGGTACCGCTGGCCATGGTGCTTGGCTACGGACT
CGCGAGGTTTAGCGCCAACGCGTCATCCGAACTGGCCAACGCCGTGTTCGCGACGGTGGCACAGAAGACCATTCGCAAGGTGGCAGTGCGCGTGTTCAAC
CACTTACACGCCATGGACCTTAAGTTCCACTTGGACCGACAGACTGGTGCGCTGTCACGCATCATCGACCGCGGTTCGCGCTCGATTGACTTTGTGCTGC
GTGCAATAGCGTTCCGAGTGGTGCCGACGGTGTTGGAGATCGGGTTGGTGAGTACCATCATGGCGACGAGCTTTGGACTGCCGTACGCTGGTGTAACGTT
GGGCACCCTTACTGCCTACACAACGTTCACGGTTCTGGTCACACAATGGCGTGATGAAATTCGTCGTGAAATGAACCGGTTGGAGAACGAAGCTGGTGCA
AAGGTTATCGATTCATTGATGAACTACGAAACGGTAAAGTACTTTAACAATGAAGAGCATGAGACCGCGCGCTATGACGAATCGCTTAAGGGATACCAGC
AAGCTGCACTCAAGACGCAGACATCTTTGGCAATGCTGAACGCTGGACAGAACGGTATCTTCAGCGTTGGTCTCACTGCGATTATGTACATGGCGTGCGA
AGGAATCGCTGCTGGTACGCTTACTGTCGGTGACCTGGTGCTTGTAAATGGTTTGCTATTCCAGCTGTCCATTCCGTTGAACTTCATTGGGAGCATCTAT
CGTGAAGTTCGACAGTCGGTCACTGACATGGAGTCCATGTTCAAGCTAGGGGCTGTTACACCTGTTATCACGAACCCAGATGAAACCCTGAGTCTAACAG
GCAGGGAGCCGAAATCAATCGAGTTCCGCGATGTGGACTTCGGATATCGCTCGGAGCTTCCGATTCTACGTAAGACTTCTTTTAAGGTAGAGGCTGGCAA
GCGCGTTGCTATCGTTGGTACGAGTGGATCGGGCAAGTCTACGGTGCTCCGGTTGCTTTACCGCTTCTACGACCCACAAAATGGTTCGATTCTCATTGAT
GGAAAGGATGTCCGTCAGTTGAGTCTTGACGAGCTGCGTCAGGCAATCGCTATAGTCCCGCAGGACACTGTGCTGTTCAATGATACGATTTTCTACAACA
TCAACTATGGTCGTCTAGATGCAACGCCGGAAGAAGTGATGAATGCCGCCCGGGTCTCGCAGATTCACCGCTCAATCGAGACGTTCCCGGACGGATACAA
CACCCGCGTGGGTGAGCGCGGATTGAAGCTCTCCGGTGGCGAGAAACAGCGTGTGTCGATCGCGCGTGCCATGCTCAAGGACTCACCGATTTTGCTGTTT
GACGAAGCCACCAGTGCCCTTGACTCGGAAACTGAGTCAGAGATCGTGCGCGAGCTCGCCGCTATCGGAGAAAACCGCACGTCACTGATCATTGCTCACC
GTCTATCAACAATTCAGGACGCCGACGAGATCATCGTGTTCGACAAGGGCCACGTGGTCCAGCAGGGATCACACGAGGAGCTGCTGCGTGACGTCGAGGG
CAAGTACGCCGAGATGTGGGGTCGCCAGAATCACCACGTGCTTGGACTGCTGGGTAGTGACAATGACGACGACGACGACAAGAACACCAAGGAAAGTGTA
TAGAAAGCTCGTAGACATGCATATGTGTGTTGTCGAACCGTGAACACTGGGTAGTTCATACATGAGCTTGTTTCTCATCTATTAACGCTTTATGATTTCA
TAAACCACATAACAGAACGACGCACACGAGTTGGAATGGGAAGATCGTGCTCTTCCTCTTGGCATGCTACTGCAAATGAACAACTTGGTTCTCCTGAGTA
ATGGCGCAGAAACTTCTCTTTATCTCCACTGGAGGCTAAGCTCAAATTTGCATTTTCAGGTATGGACCTTATTCCAAATGCTGATTGGCCATCTATCCTA
ATATTTAGGTTGCGCCTTTACGACCGAGTTGCCAATTACGAGCACGCCAACAATAGCATCGCGCATCGCAGCCGTGGTCGCCATGGACGCGCTGCTGGTG
AGCGCGCAGCGCCTGAGCAGCTCGAGCTCCAGTTCGTACAGTTCCAGCGACGACGAGCCGCTCAGTCTCAGTCTGAAGCGCCGCGCCCCGATGCCGCCTC
CCCCTCCGCCAGACTCGCCGCCGCCAGACATGACGCCGCCGCCTCCGCCTGGTCCGCCTCCACCCGTTGATACAAACCACAAGTTACCGCGGCCTCGACG
TACGAAGACCGACACTACGACAACCAAAAAAACAGTCAAGAAGGCAGCACCCAGACGGCAAGCGTCTCCAGTGAAGCAGCAACTGATTGAAGTGTCCACA
GCTGAGGAAGAAGAAGATCTGGACGCGTACTCGGATGCGTCAGACGTGTTTGAAGAGGACGTGGAGGCCATTTTGTTTGCAGAGGAGGAAGAAGACCGAC
GCAGAGGATACACAGACTGCCTGACGGAAACGCACTTGGACACTGCAGAGTACCCGTATCCGGCGTACTTGGCTAAGTTGTCGACCTTGTTTACAGAGCA
AAATGCCTTCGGAAAGAATCCCGAGGACTTTATTTATTGCAACAATTTGCTGGTATGTTGCAAAGATTCTGAGATGGAGTCCTTAACGCTAATGGGGTCG
TTACTACAGGTTAATCCAAGCCAATTCAAGCTACTGGACACTCGGACTGCTGCACTTGAACAGGTCAAATTAGAACAAGTGCGTAAAGCAGCAGCATTAA
AGGCGAAAGAGGAAAAGCAGAGGAGGCATCAAGAAAGGTAAATGCTGTATGCTGAAACTTTAAAACATACAGACAATAACTTCAAAATGGTCGTTGTGGT
GTCTAACAGACTGATGGAAGCACTGGAACCGCCTTCAAAGAAGATCAAAATATCGGAAGCCACTCTGAAAGCCCTGGAGGCCAAACAAGCGGTATCTCTG
AGCAGCTCGAGATCGTTGAGCAACCCATCGCGGAAACGAAGTCGAAAGAAGCCCACTGCAGCAGCAGCATCTACAAAGCCAGCCACACCTGCTTCATCGA
ACCCTCCTAGTGATGCCTCTACCAGTAGTACAAAGAAGGCAAAACCGAAGAAGCCTTCGTCAGCACAGACAACCAATGTCAATGGAAAGGCGAATGGAAG
TATCGCAACTGTTGCAGCTACCAAGAAGAAGACGACGTCGAGCACCCGCACCAAGAAAACTACAACTGCTGCAGCTCCCACAGTCACCAAGGGTGCTCCT
AAAAGTGCAAAGGCTCCCAAGACAGCCAAAAGTAATCAGGCCAAGCTAAAACCGGTCATTGCCGCTAGTGGTTCCAAGGAGAACAAAGTACAAGCAGAAA
TCGAGAAGATTCGTGCCGAGGCAGACGAAGACCGTGGCAATGAGAGCTCCTCCTCCTCTTCTTCTTCATCTTCATCGTCTTCGTCATCTTCGTCGTCTTC
GTCGTCCTCATCTTCGGTGTCGTCTCGATCGTCAGCATCCAGTAGTTCATCTGACGATACGGGTGGTGACTAGGAGTCCTCATTGATGCGTCCAAACCGA
ACGGAACAAAAGTTTTCGCTACATTTTAATGCTACCATCGCTCGGTTCTCACAGTACATTCTACTCCTCCTTCGCATTACGTTCATCCTCCTGCTTCTTT
GCCCAGATATTTGCCGACTTGATGCCCAATTCAAACAGTTGATCAAGCACTTCAACTTGTGGTGGGAACAGTGCAAAGCGTGCCAACTGCATAATGGGGA
ATGGGAACTCCGGATCGATCGATGGACTGATCTCGTAGTCGTCACGACGGAGAATATGCGCGTGGAAGGCACACACCTTGGTGTATCCCGGCACTTCCGG
CACCAAGGTGAGGAGGCCTCCATCCACATGGTATTCTCCTCGAAACACCGAAGTGCCTCGCTTGGCCAAGTACCAAGGGATGTAGCACGATGCAATGAGT
GCATCACATAGATCATCCGTTGAGTGGAATGCATCAGTATGCACCATTGCTCGAGCAGGCCACATCTTCTCCGTAGCGATCGTAAGGCGTTGGGTCAGCA
TCTCGACAGGCAAATCACCAAATTTCGTGTGGAAAATGGTCCGCAGTCGCTCCTCGAGCTTCCAGACTGTGCCTTCATTATGACAGAGTCTAGCCATGGC
TTTAGTTTCCTCGTGAATGTCGCTCATGCTCGAGTTGGCTGCTAGACTCAAGGCAGCGATGGCACCTCCTGAAGCTCCAGCAAACTTGGAATTAGTCTGG
ATAAACCCAGCATCCTGTAGTCCCTGTGCCACCCCCAAGTGATACGGGATCAGGAATCCACAGCCACTGAAGCTGAAGTTGTGCG