Description :
From Genome Similarity Track
Location :
Scaffold_675:4280- 6984
Sequence
2704 bases(100 bases per row)
GTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAG
GTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAAA
TATACCTAAGTTTCCTCTTCCTTGTTTGTCTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGATAATGTTCAGCTTG
GTATCCATAAAGGATTCCACCTGTTTCCACAGCGAAACCGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAG
AGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTT
GAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCT
GTTTGGCCGTCGGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCGGCAGTGAACCGCGGGT
CTCGGTCCGAGACAATCGTCTTCGGGAGACCGTGATAGCGGAGCACGCCATCGACGAACAACCTGGCGGTTTGTTCGCCCGTTACAGTGACGGGAACTGG
AGCAAGATGTACCGTCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATC
GACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGGAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTACC
GGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGGGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGC
CTCCGCGAGGATGTCGAGCTTCAGATCCTCGTCGTTGGGTACGACCATTCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAAC
TCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCAT
CGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGGGCGTCCGCAAG
CACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGCATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTC
GCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCT
CCTTGTCATGGACAGGGTAGTCCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAACGAGATGACTCGTTCCTGTCCAGCCGTGTCGGCCTGCAGCAATGC
ACATCCGATGGCGTAATCGGAGGCATCGCAGACGACCCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATG
CTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGT
ACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGC
CCGAACGCCCACGTTGCTTACGAAGCAACCGAGATCTTTGATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATC
ACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTA
CGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCAT
GCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTC
CCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGCTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACT
TTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAAT
GACCTCGCACTGCTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGG
AGTT