Description :
From Genome Similarity Track
Location :
Scaffold_2285:428- 4068
Transcript NameFunction/comments
Phypl_g14910hypothetical protein PHYSODRAFT_338895

Sequence
3640 bases(100 bases per row)
TGGGATATACTGGGCGCACCACTGCCGGTCCTGGATCAGTTGGGTCTACCTCCGGGGGAACGGCTTCTACTGTCGCTTGGAAAGCCAGATTCTGCCATTC
GTTGTAGCGACGCGACCCGATCGAGACGAACCCTGGTAGACGGGGAACTCAATCTCCAGCTAGCCACATCGCGATCCGTAATCCTGTTGGAGGATGAGGC
GGCGATCACTGACATTCATGATCCGCAGGTATCGGCGTCTTCCGGGTCCTCCCATCGCCGTCGGCACCCAGCGATCTCCGCGTGTAACCCATAATTTCTC
TCGATCAGATAACGCACGTAAACGTATAGGAACTTCACAAGACTCCCCGATCTCGATCTGGATATGTTCACCTATTGTCACCAGCTGGGCTCGATCATTG
TAAAGCCGTCGTCGACCGCTGAGTTGGATCTTGATCTCATCTGGTAGGCAGATTGACCCATCTGCCAGATCAAGTCTAATCCCAGCGGGGACCATGAAAT
CTATCCCCAGAATCGAGTCTTGACCCGACAGATCTACCACCCAAATATCGAAAAAGTAGACCAGCGATCCCGCCAGGGTGATCTTGAACCGCGTCCTTCC
TTCCGTGACGTACACGTTTTCGCCGATCCCGACACACTCCTGACTCTGACTCCCATCGACATGGCTGGCACCCAACCTTACGAGCAAAGGCGGTGTCCAC
AATGGACACCTCGGCACCAGTAACTAAGAGTAAGATCGCCTTATCATTGTTGATCTTGCCTGTCATCTTCGCCTGTCGAAACCACTTCTCAGGGGCATGA
TGTTTCCAGTAGCCTCGGGACTCTCCTGGTAGGAGATCCAAAGACATCATGACGTCCGATCAGCGATATTCATCGACCTGGCGGAAATTTGAGATCACAG
CAGTTCGTTTCCCATGGAGATCGCATGTGTTATCGCGTAGATCTTGTTGCTGGTCGCTGACTTGATCTATCGACTTCTTGTCCACAAATGCATAAACGCA
GAACCTAGAACGCTCGGCTCGTATCGGGTTCCAACCCGACGAGCGTCTTAGTTTAACATCTTCTCAGCCAGTGCAGGCAACATGCCTGCATGCTTCGTAG
GGTTGTACCACTGACGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTCCCCGTGTCGTGAAGCTCTCCACACCCGCGGAACACGCACAGACAGTGCTC
GGCAGGGTGGCCTCGCTTACCGCATTTCTGGCACGTCAGACGTTTCCAGCAGTCCAGATCCGTATGCTTACGGGAACCACAGCGCGAACAGCGACTGCGA
TCCGATCCGTcgggaggcagcagcgatctGCGACCATGGGGCACCTGATCTGTCGCGATCCGACCCGGTGGTAACCGATCTGCCTGGGCTGTCTCGCCCC
CTTCCGGAGGTGGAGTAGCTTCTGTCGATGCAAGGTAGATCCGACGTAGATCGCCCTCTGAATCAGATCCTCCGGATCCGTCCGAGCTGGAGTCCGATCC
CGACGGAGGAAGCAAAGACTGGATCGCGCGTACCGCTCTCTTGGTTGGGGCGGCTGACACAGCTGCAGGGGACTTCTGTCGATACTTGGATCCGAAGGCC
GATCGCTTCTGTCTACTCTTCGCccgttctcgagctcggAGGACTTCTTCCAACTCATCAGCATCCGAAAGCCGTAATAGCGTCAATTGGTCCGCCAGAT
CCTGATCTCCGAGTGTTTCGATGTAATGACCGACGTGCTCGCGGCGGTCCTTTCGGTCGCCGTTCCTGATCTTCAGTCGTGCACGTAAACCTGCCACATT
CAACCGGTAGGGGTACTCCAGCGGTGATTCCTCCGATCGCTTGCGAGCATGATAGTACTGCCATGCGACCGAGACTCCAAGTCCGCAGTACTGGACTTGA
AAGCTGTGAAGCAGATCGCTCCACTTGTTCCTCGTCGATCGGCTCAACTGGCGGTACCAATTCCTGGCAGGACCGGTCAGCAAGTCTGCGGAGGTCAGGC
ACTTCTCGTCATCCGAGGCTTGATCTCGTAGGAACGCCGACTTGACCTTACTGATCCATGATCTAGCACGATCTTTGCCTTGATCCTTGCTAGTAAACTC
TTTTAGATCCGAGATCGCGGAGATTCGGACACGCTGGATCAGTGAAGATCCGCCTGATccggtggtggcggtcgcCACCACTGCACGGCCAGAGCTTGGC
ATATCGAGATCGTCTGGGTCGTACTCTCCGTGAGATGAACGATTGTGCGGCGATCCCACCGACTCCATATCCACATCTTGAGCCCCCGCATACTTCGGTC
GATCTGCCGCTTCCGGTGTGATCGTTATCTGTTGTTCCTTCAGGAATCGGGTCATGGCGGCTTGGAAATATGTCTCGAGCTTATCCGTCGGATCCTTCGG
CGTCACCACGTCCGTGATCTGGATAGCTGGGCTCGATGACTTCTTCTGTCGATCTGCCTTGGACGGTACACGATCGGGGGACTTCAGGCGGGATCGCAGT
AGCGCTGCACCAGAAGGTCCTAGTGACATCCNCACCTGAGGGTCCTAACGACATCCGTCGTGGGACGGTCGAGCTGTCCGAGTCTGGCTCTGAAGTGGCC
GATTCGTAGTGCGATGATCCCGTTTGGActtcggtggtgctggccggTGTAGACAGCTGCTGATCCCGCATCGCAGGGGTTTCACCCACTAGGAGCTTCA
GTATCTCGACCAGCTTATGCGTTGCGGATCGGATTACNGCACTAGGAGCTTCAGTATCTCGACCAGCTTATGCGTTGCGGATCGGATTACTTCCAGATCT
AGATCGAACAGATCGTCGGCATCGAACGCTCCTGCCACCAGACCAGCATCCTTGAGTAGCTCGAACAAGACCttcaccgcgtccagcttgttcGACGTCG
CCAGAGGGATCGCTACCGGACCCTTCAGATCACCGATCAGGCGTACCTGCATGATCCTCATCACCGGATCATGGACCAGGAAATCGCGTAGGGTCTTGTG
GTGATACACGATCTCGATCGTGTCAGCCGACCACGTCGCTGAGAGTGTCACAGTCGGATCTTCCACATCTGACTCTGgtgccttcagcttcttcttcgca
accttgctcttcttcttctgcgacgACCTCGCAGGGATATGAGTCGTGAACACATAAGATTCAGCCCGGACCTTCTTCTCTTCACTAGGAGTAGCGAACG
AGTAACGTTCAGGCTTGATCTTCCTGTGTTCACTCGGCAGATCTCAATTCGCATCGAGATCTGCGGGGGTCCCCGAAGGGACCTGGGGAGGAATTCGAGG
TTTCTCTTCTAGATCCGGATCCGGATCGCCCTCATTTCTGTCAATCGAGCTTCTCCCAGGGCTCTGCTGATCTGCGGATCTTGTTTCAttcagcggcgtc
gtcgtcgatccgATCTCCGATGACGCTTGGTCCCCTTGTTCTTTCTTCACTTgtgcatcttcttctgcgaaGTCACGGTGAAATCCTGAGTCGCCAAGTg
atccgggcacgcgcaccattGTGGTGTAGTGGGATCGGCCAAAAACTTGTTAAGGCCAGATCGAGCTTCCCAACAGCGCCCAGAtaccgactaacggagg
gggtccCCCGATGTTCCGTGATCTGCTGAACTTGTTCTCA