Description :
From Genome Similarity Track
Location :
Scaffold_684:428- 3532
Sequence
3104 bases(100 bases per row)
TGCTGGCTGTTTCGTACTCTTCGGATGTGCATCAGAAGCTGCAGAATGGCAGCGCGGTCGCCCTGGTAGATGCTGCGCGCGCGGCGTAGCAAGTGAAGCG
GCATCGTCTGTTTGTTTCGGCAGGAAGTACCACATCGTTGTCACTTTCATGTGTCAACAATGCAGGATTCTCAATACACCCAACCTTTTTGCTTTGCAGG
ATGGAGAGCGCCTTGTTAATATTGTGCAGAGCGCTCGCCTTGGAAAGGTGCCCTTCCTTCGAAACGACACCTGGGATCCCGCGCATGAACTCAACGCGCT
CGACGATTTCGCACAATACAATGCCCGACTGGAACTCGGTCAGTTTTGTCAGCGGATCCTACCAACAAAGATGGATTAGCTCAGAAATTTGGCGACACAA
TCCATATCGAGTGGGGATAATAGAACTCTACTCGTAGAGCAGCTGGGTTCTTGAGACGAACGTTCAACAGTCTAAGCCACGAGATGATTGGCTCCACACA
GTCTTTGGCTAGGCTATCCGCGGTTTTCACAGCTTGAATGCCCCTCCCTTGGTGTTTTCGCTGCAGTTTTCGCTTGAGGGACTCAAGAGCTCGAGCTGGT
TGATCCGAGAAGCCTGCCCATCCAAATTGAGAAATGTTAGCATACCGTACATTCATCCATGCATTCTGAGCAGTACCAATGGTGTCAGCAACTTTTCTTG
AGAGTGAAATTGAGCTGAGTGTTGGTTTTGTATCTTGGTCCGATGGGCTGTATTCGATGGATTGTGGAACATCTGATCGACAGCAACAACCTGCAGACTC
GGACTGCGGAGTCTCTTTGGTTGAAGATGTAACTTCGCTCTGTGGCACCGGAACAACTGTTGCCGGCGATGATTGCTGCCTAACGGGGAAGAGATCGTCG
TCTTCGTTGATCTCTGACCCCCACAAGATATTTCCGGATACGGTATGGTTGCTCGCCGAATCGATAGCGGAGATATCGGGCGTGAATGGGGTCTGATCCG
AGCAAAAAGCAGCAAGATGATTTGACCTCTCGCTGCTAGGAGAGTCCTCCTGGTGCTCACAACTCCAGCAGTCTGGATTTGAAGTGATTTGTTGTTTGTG
GTCTTGGTGAGTTTCGCCAGAAACACGGAGCTTGCGCAGATGCCATAGGATCTCGTACAGCAGCGATTGGTCTCCACGGAGAATATCCTCAACGCAATCC
TCTCCGTTGTTGTTTGCACACCCTGAGTTCCTCAGGATGTCGGCCAGATACCTCAACGCCGTGCGAATGTTCTCCCTGCGCGAAATGTCCGACTTCAGTT
AATCATAAGACAATATAACCATGAACAGAGGGTATCGCACCTGACTTCTGCCAGTGATCGAGGAGTTTTGTAGTACGATAAAGGTCCTCTGCCTGGAAAC
TCCTGCAGACAGAGTGCACTGATGGACAGATAGTATCAAGTCGACTATATCGCTCTGATTTGTGCCTCAGATCAAAGCGGTGAGAAAATACCAGAGCAAG
ACTCCGTTGCGCATCGTATCCTGCAGAACTCCTTGAGCGGCAGACTACGAAACAAACGAATCGTTTGTTAAGTGTACGACATCACAAACCATCGTTGTTT
GCTCGGTTATTCTCACATGCGTATTCAGTCCCAGCGAAGCCACCCATTCTTCCACTAGCTTTGTTTGCCTTGCCGAAATACGCCTCGGCGCTGAGCGTTT
ATCCTTCAGAGGTCCCTCGATACGTTTTGGTGCCTTGGAATCCTTGTTGATCGCCGCTTCATCCTGTCTACGTGAGTTGCGGATATGGTGTGCACCTTGA
CCGTACAATATTCGCGGTGCCACATTTAGTCGCAACTCGTCAAGAGCTTTCCAAATCAAAACCGCGTCGTCCTGCAAGGGCTTTCCACCACGCAAGCGGT
CAACAGCTCGGAGGGATGAATCGGAGACGCCAAGTCGCTCAAACAAATCACGGGCGACAAGGATGTTGCGACGCGACTGGTTCGGCGATACCTTGCTTGA
GTGTGGTGTTGAATCGGCAGCGTCAACCTTGTCAACAATCTCCTCATCGCGACACACTCGGCGCAGGACCTCAGCAGCGATTCGAGACAGAAGCACGCCA
TCATTGAACAATTCGTGTGTTTGGCTCATGTGATTTGATCCCTGGGTCTCTTTCCTCAGGAACCGCTTCATTGGAAGATCAATTCCGAGCTCGACGTCCA
CCCACAGACAGACTCTTGTCACCAAATCATCGCAATATCCGTCTTTGTAGCGTTCTGTTTGCTTCTGGACCTTTGGCTTTGCGACTGGATCGAGCATCCC
GAACACGTGCAGCCCCTGGCTATCCTGGTACTGAGCTCCAGCACGTACGATCGCGCATTTGGCGGCAGGGTTTGGTGTTGTTCGAGGCTTCGGAGTGTGT
TTGGCGGGTTTGTTAGCGGGTCGAGGTCGTTTTCCTGTCGTTGTAGCGTCTGCAGTTGCAGCGCGATTCGTGCTACGACTTTTATCATTCGACCGAAAAG
GCTCAGACTTGACTGGACGTCCAGGCTGAGTCATTGGTGCATTCTCGACGATGGCGGTATGCATCGACTGAGCTCGCTCTATAAGCGCGGCCTGCTGTCC
TCTGAAGTGGAATGAGGCTTTCGTCGCAAGTGATTCAGTGCGCTGCCTTTCAGGTGGCGAGCAGCTGCTCAAGCGCTTCAGAACCTCCAAGACCGCGGCA
ATGGCTGCGTAGTCGCCCTCCATGACGAGCGCAACGCAGTCGGCACTATTGACGACGACGGCGGCATCGCCATCGACGCTGCGACTCTCGCTCGCGGCGA
ACTGCACGACAGCACGCACTCGACGGGCAATTAAACCTCCTTCGGTGAAATCAATGCTGCCATCATTGTCCTGACGCTCGATGCGCTCGCCCCAGTGGCT
ACGGCGCTGGGACTGCAGCGGACACAGGTCCCGCATTCAGTGATTGCGTGACGATCGATCGGACAGCCTGTTGTCGTACCTGGATCCACGTGATAATATC
AGCGAGCACGTCGCCGAAGCGCAGATCGACGAGGTCGTCCACCAGCAGACACTTGGTCGGCGGGAGCGAGTTGACCCAGTGGAGCAGCAGTCGCGCGCGG
ATGC