Description :
From Genome Similarity Track
Location :
Scaffold_1500:428- 1844
Sequence
1416 bases(100 bases per row)
AACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAA
CCTAGTGAGCTTTTCCTTTACTCGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGTTCTCAACTCTCAAGATCCCGT
CACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCGGATCCACGATCTAGGCCCCGGATC
CATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCACGACA
CTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGA
TCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTGGCTGATCCCGCTACACCACAATGGT
GCGCGTGTTCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGACGCTCAAGTGAAGATTAAGCCAGGGGAAGAGGCGTCGTCGGAGGTC
GGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCT
AGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACTTGGGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCG
AAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACTGTACCTAAACCCAGCCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGA
CTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCA
AGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAATG
GCGAACAAGTTGGTAACAGTCATGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGATC
TGGATCTCATTGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCGCTATGGATCCAGTGTCATCGCCGAGGAT
CAGCCAAGCTGCGTCC